Incidental Mutation 'R6140:Cspg4'
ID519592
Institutional Source Beutler Lab
Gene Symbol Cspg4
Ensembl Gene ENSMUSG00000032911
Gene Namechondroitin sulfate proteoglycan 4
SynonymsAN2, 4732461B14Rik, NG2
MMRRC Submission 044287-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6140 (G1)
Quality Score63.0073
Status Validated
Chromosome9
Chromosomal Location56865033-56899870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56897224 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 1773 (H1773L)
Ref Sequence ENSEMBL: ENSMUSP00000038909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035661]
Predicted Effect probably benign
Transcript: ENSMUST00000035661
AA Change: H1773L

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000038909
Gene: ENSMUSG00000032911
AA Change: H1773L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
LamG 47 179 9.16e-22 SMART
LamG 223 364 3.52e-23 SMART
low complexity region 384 397 N/A INTRINSIC
Pfam:Cadherin_3 495 646 1e-36 PFAM
Pfam:Cadherin_3 732 885 7.9e-14 PFAM
Pfam:Cadherin_3 868 996 7e-15 PFAM
Pfam:Cadherin_3 972 1115 9e-26 PFAM
Pfam:Cadherin_3 1116 1223 1.1e-10 PFAM
Pfam:Cadherin_3 1225 1344 3.3e-12 PFAM
Pfam:Cadherin_3 1425 1568 6.3e-52 PFAM
Pfam:Cadherin_3 1578 1684 9.7e-9 PFAM
Pfam:Cadherin_3 1674 1809 3.2e-9 PFAM
Pfam:Cadherin_3 1779 1929 1.6e-31 PFAM
transmembrane domain 2229 2251 N/A INTRINSIC
low complexity region 2295 2305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217052
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.9%
  • 20x: 91.8%
Validation Efficiency 100% (46/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A human melanoma-associated chondroitin sulfate proteoglycan plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. CSPG4 represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display abnormal dentate gyrus morphology and abnormal smooth muscle cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,005,922 probably benign Het
Adgra2 A T 8: 27,115,405 R593W probably damaging Het
Agfg2 T C 5: 137,667,085 Q136R probably damaging Het
Ankrd42 T C 7: 92,591,828 probably null Het
Baz2b T C 2: 59,912,527 D1643G probably damaging Het
Ccdc171 C T 4: 83,696,317 Q1060* probably null Het
Cela1 C T 15: 100,681,156 R207H probably benign Het
Clic6 A G 16: 92,539,492 R563G probably damaging Het
Ddrgk1 A G 2: 130,658,614 V204A probably benign Het
Dhrs7c A T 11: 67,815,074 T218S probably damaging Het
Dlgap4 A T 2: 156,762,729 probably null Het
Gm4788 A G 1: 139,732,395 V664A probably damaging Het
Hgd A T 16: 37,589,713 Y37F probably benign Het
Hmcn1 A C 1: 150,732,846 N1528K probably damaging Het
Hps3 A G 3: 19,996,987 F843S probably damaging Het
Ifih1 A G 2: 62,601,460 F800S possibly damaging Het
Igsf21 T A 4: 140,107,373 T63S probably benign Het
Il18rap T G 1: 40,525,052 M110R probably benign Het
Kcnk2 G T 1: 189,209,907 H384Q probably damaging Het
Lima1 C T 15: 99,781,058 V341M probably damaging Het
Lins1 T C 7: 66,711,924 L441P probably damaging Het
Lss T C 10: 76,550,688 Y642H probably damaging Het
Mrc2 A G 11: 105,346,789 T1098A probably benign Het
Nf1 T A 11: 79,473,320 probably null Het
Nrd1 G T 4: 109,049,111 A730S probably damaging Het
Nup214 C T 2: 32,051,796 T72I possibly damaging Het
Olfr1082 A T 2: 86,594,104 C241* probably null Het
Olfr806 T G 10: 129,738,654 K88Q possibly damaging Het
Olfr952 A G 9: 39,426,247 S275P possibly damaging Het
Oxt A G 2: 130,576,271 Y21C probably damaging Het
Pla2g12b G A 10: 59,421,441 probably benign Het
Ralgapb T C 2: 158,456,572 V907A probably damaging Het
Rnls A T 19: 33,138,200 D157E probably damaging Het
Slc7a14 C A 3: 31,237,548 V194L probably benign Het
Slc7a7 G A 14: 54,379,058 T189I probably damaging Het
Snupn C A 9: 56,982,824 Q310K possibly damaging Het
Ssh1 A G 5: 113,942,631 Y891H probably benign Het
Suclg2 T C 6: 95,569,721 D258G probably damaging Het
Tpk1 A T 6: 43,423,701 M129K probably benign Het
Ubr3 A G 2: 69,973,329 I1088V probably benign Het
Vmn1r3 A G 4: 3,185,031 I92T probably damaging Het
Vmn2r69 G A 7: 85,411,449 S309F probably damaging Het
Wsb1 A T 11: 79,241,618 H325Q probably damaging Het
Zfp263 A G 16: 3,748,217 S281G probably benign Het
Zfp507 A G 7: 35,794,188 S477P probably damaging Het
Other mutations in Cspg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Cspg4 APN 9 56898865 missense probably damaging 1.00
IGL01322:Cspg4 APN 9 56898588 missense probably damaging 1.00
IGL01922:Cspg4 APN 9 56887887 missense probably damaging 1.00
IGL01993:Cspg4 APN 9 56898478 missense probably benign 0.09
IGL02379:Cspg4 APN 9 56892609 splice site probably benign
IGL02398:Cspg4 APN 9 56886686 missense probably benign 0.43
IGL02503:Cspg4 APN 9 56897403 missense probably damaging 1.00
IGL02504:Cspg4 APN 9 56885772 missense probably benign 0.06
IGL02692:Cspg4 APN 9 56887454 missense probably benign 0.00
IGL02728:Cspg4 APN 9 56886481 missense probably damaging 1.00
IGL02806:Cspg4 APN 9 56890259 missense possibly damaging 0.57
IGL02886:Cspg4 APN 9 56897388 missense probably damaging 0.99
IGL03005:Cspg4 APN 9 56888488 missense probably damaging 1.00
IGL03008:Cspg4 APN 9 56898475 missense possibly damaging 0.48
IGL03202:Cspg4 APN 9 56897739 missense possibly damaging 0.93
chiclets UTSW 9 56885222 splice site probably null
R0066:Cspg4 UTSW 9 56888134 missense probably damaging 1.00
R0066:Cspg4 UTSW 9 56888134 missense probably damaging 1.00
R0254:Cspg4 UTSW 9 56897410 missense probably damaging 0.98
R0284:Cspg4 UTSW 9 56886139 missense probably damaging 0.96
R0513:Cspg4 UTSW 9 56898091 missense probably benign 0.03
R0602:Cspg4 UTSW 9 56888017 missense probably damaging 1.00
R0747:Cspg4 UTSW 9 56890280 missense probably damaging 1.00
R1005:Cspg4 UTSW 9 56888736 missense probably benign 0.13
R1421:Cspg4 UTSW 9 56896626 missense probably benign 0.00
R1443:Cspg4 UTSW 9 56886512 missense probably damaging 1.00
R1481:Cspg4 UTSW 9 56887810 missense probably damaging 0.98
R1585:Cspg4 UTSW 9 56898867 missense probably damaging 0.99
R1624:Cspg4 UTSW 9 56888470 missense probably damaging 1.00
R1670:Cspg4 UTSW 9 56897403 missense probably damaging 1.00
R1721:Cspg4 UTSW 9 56888743 missense probably damaging 0.98
R1728:Cspg4 UTSW 9 56898537 missense probably benign 0.00
R1729:Cspg4 UTSW 9 56898537 missense probably benign 0.00
R1763:Cspg4 UTSW 9 56886979 missense probably damaging 0.97
R1772:Cspg4 UTSW 9 56897492 missense probably benign 0.02
R1938:Cspg4 UTSW 9 56887101 missense probably benign 0.00
R1975:Cspg4 UTSW 9 56890478 missense probably damaging 1.00
R2064:Cspg4 UTSW 9 56896656 missense probably damaging 1.00
R2185:Cspg4 UTSW 9 56886972 missense probably benign 0.37
R2252:Cspg4 UTSW 9 56898046 missense probably damaging 1.00
R2291:Cspg4 UTSW 9 56892743 missense probably damaging 0.96
R2329:Cspg4 UTSW 9 56888550 missense probably benign 0.00
R3780:Cspg4 UTSW 9 56888233 missense probably damaging 1.00
R3830:Cspg4 UTSW 9 56897621 missense probably damaging 0.99
R3944:Cspg4 UTSW 9 56886123 missense probably damaging 1.00
R4011:Cspg4 UTSW 9 56887317 missense probably benign 0.19
R4115:Cspg4 UTSW 9 56898394 missense probably damaging 1.00
R4173:Cspg4 UTSW 9 56887930 missense probably damaging 1.00
R4243:Cspg4 UTSW 9 56887857 missense probably benign 0.12
R4329:Cspg4 UTSW 9 56892465 missense probably damaging 0.99
R4544:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4545:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4546:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4649:Cspg4 UTSW 9 56886865 missense possibly damaging 0.93
R4663:Cspg4 UTSW 9 56886676 missense possibly damaging 0.61
R4674:Cspg4 UTSW 9 56898205 missense probably damaging 1.00
R4779:Cspg4 UTSW 9 56885808 missense probably damaging 1.00
R4884:Cspg4 UTSW 9 56898069 missense probably benign 0.00
R5021:Cspg4 UTSW 9 56897730 missense probably benign 0.01
R5051:Cspg4 UTSW 9 56885736 missense possibly damaging 0.95
R5328:Cspg4 UTSW 9 56885856 missense probably benign 0.01
R5394:Cspg4 UTSW 9 56890200 missense probably damaging 1.00
R5567:Cspg4 UTSW 9 56886648 missense probably benign 0.00
R5682:Cspg4 UTSW 9 56886196 missense probably benign 0.14
R5690:Cspg4 UTSW 9 56898735 missense probably benign 0.01
R5715:Cspg4 UTSW 9 56891051 missense possibly damaging 0.90
R5717:Cspg4 UTSW 9 56885798 missense probably benign
R5726:Cspg4 UTSW 9 56885904 missense probably damaging 1.00
R5898:Cspg4 UTSW 9 56885222 splice site probably null
R6147:Cspg4 UTSW 9 56888772 missense probably damaging 0.99
R6239:Cspg4 UTSW 9 56888182 missense probably benign 0.04
R6343:Cspg4 UTSW 9 56892692 missense probably benign
R6351:Cspg4 UTSW 9 56892644 missense probably benign 0.00
R6564:Cspg4 UTSW 9 56890158 missense probably benign 0.02
R6814:Cspg4 UTSW 9 56890340 missense possibly damaging 0.91
R6928:Cspg4 UTSW 9 56897880 missense possibly damaging 0.95
R6967:Cspg4 UTSW 9 56890136 missense possibly damaging 0.52
R6981:Cspg4 UTSW 9 56887101 missense probably benign 0.00
R7033:Cspg4 UTSW 9 56888074 missense probably damaging 0.96
R7419:Cspg4 UTSW 9 56888443 missense possibly damaging 0.94
X0065:Cspg4 UTSW 9 56885736 missense possibly damaging 0.95
Z1088:Cspg4 UTSW 9 56886036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTCTTCTTCCAGTGGAC -3'
(R):5'- ACGTCCCTCACAGTGATGAC -3'

Sequencing Primer
(F):5'- GGACTGGACCTTCATAGCCTATG -3'
(R):5'- GTCCCTCACAGTGATGACAAAGG -3'
Posted On2018-06-04