Mutagenetix > Incidental Mutation

Incidental Mutation 'R6164:Ppp1r9a'

519605

Institutional Source

Beutler Lab

Gene Symbol

Ppp1r9a

Ensembl Gene

ENSMUSG00000032827

Gene Name

protein phosphatase 1, regulatory (inhibitor) subunit 9A

Synonyms

A230094E16Rik, Neurabin I, 2810430P21Rik, neurabin-I, NRB, 4930518N04Rik

MMRRC Submission

044310-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.566) question?

Stock #

R6164 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4902917-5165661 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

C to T at 5110715 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134943 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035813] [ENSMUST00000175889] [ENSMUST00000176263] [ENSMUST00000176729] [ENSMUST00000177153] [ENSMUST00000177456]

AlphaFold

H3BJD6

Predicted Effect

probably benign
Transcript: ENSMUST00000035813

SMART Domains

Protein: ENSMUSP00000046906
Gene: ENSMUSG00000032827

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDZ	513	593	4.26e-18	SMART
low complexity region	608	620	N/A	INTRINSIC
Blast:PDZ	741	778	5e-15	BLAST
low complexity region	784	798	N/A	INTRINSIC
SAM	986	1052	6.41e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000065842

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000164110

Predicted Effect

probably benign
Transcript: ENSMUST00000175889

SMART Domains

Protein: ENSMUSP00000135629
Gene: ENSMUSG00000032827

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDZ	513	593	4.26e-18	SMART
low complexity region	608	620	N/A	INTRINSIC
Blast:PDZ	741	778	2e-15	BLAST
low complexity region	784	798	N/A	INTRINSIC
SAM	986	1041	1.72e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176136

Predicted Effect

probably benign
Transcript: ENSMUST00000176263

SMART Domains

Protein: ENSMUSP00000134937
Gene: ENSMUSG00000032827

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDZ	513	593	4.26e-18	SMART
low complexity region	608	620	N/A	INTRINSIC
low complexity region	643	649	N/A	INTRINSIC
Blast:PDZ	763	800	2e-15	BLAST
low complexity region	806	820	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176729

SMART Domains

Protein: ENSMUSP00000134909
Gene: ENSMUSG00000032827

Domain	Start	End	E-Value	Type
low complexity region	96	115	N/A	INTRINSIC
PDB:3HVQ\|D	116	232	4e-79	PDB
SCOP:d1be9a_	174	232	5e-9	SMART
Blast:PDZ	193	232	1e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000177153

SMART Domains

Protein: ENSMUSP00000135485
Gene: ENSMUSG00000032827

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDZ	513	593	4.26e-18	SMART
low complexity region	608	620	N/A	INTRINSIC
Blast:PDZ	741	778	2e-15	BLAST
low complexity region	784	798	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177456

SMART Domains

Protein: ENSMUSP00000134943
Gene: ENSMUSG00000032827

Domain	Start	End	E-Value	Type
low complexity region	416	435	N/A	INTRINSIC
PDZ	513	593	4.26e-18	SMART
low complexity region	608	620	N/A	INTRINSIC
Blast:PDZ	741	778	2e-15	BLAST
low complexity region	784	798	N/A	INTRINSIC
low complexity region	966	987	N/A	INTRINSIC
low complexity region	1040	1049	N/A	INTRINSIC
low complexity region	1103	1114	N/A	INTRINSIC
SAM	1183	1249	6.41e-16	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.3%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is imprinted, and located in a cluster of imprinted genes on chromosome 7q12. This gene is transcribed in both neuronal and multiple embryonic tissues, and it is maternally expressed mainly in embryonic skeletal muscle tissues and biallelically expressed in other embryonic tissues. The protein encoded by this gene includes a PDZ domain and a sterile alpha motif (SAM). It is a regulatory subunit of protein phosphatase I, and controls actin cytoskeleton reorganization. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defects in dopamine-mediated neuromodulation, deficient long-term potentiation at corticostriatal synapses, increased spontaneous excitatory post-synaptic current frequency, and enhanced locomotor activationin response to cocaine treatment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030419C18Rik	C	A	9: 58,499,247	P147T	probably damaging	Het
Anpep	A	G	7: 79,842,205	I16T	possibly damaging	Het
Ap1s1	T	C	5: 137,037,386		probably benign	Het
Atp1a2	T	C	1: 172,278,892	S848G	probably damaging	Het
Bche	T	A	3: 73,701,056	I346F	possibly damaging	Het
Ccdc148	T	A	2: 58,823,633	Y502F	probably damaging	Het
Ccdc88c	T	C	12: 100,953,383	M416V	probably damaging	Het
Cdk17	T	C	10: 93,235,469	S351P	probably benign	Het
Cfap100	T	C	6: 90,415,786	E114G	probably benign	Het
Clec4a4	T	C	6: 122,991,874	I66T	possibly damaging	Het
Cpeb4	T	C	11: 31,920,584		probably null	Het
Cybrd1	T	C	2: 71,118,274	V52A	probably damaging	Het
Decr1	G	A	4: 15,924,347	A191V	probably benign	Het
Dnah5	A	T	15: 28,378,343	I2942L	probably benign	Het
Ehd4	C	T	2: 120,102,208	V246I	possibly damaging	Het
Ercc6l2	A	G	13: 63,872,344		probably benign	Het
Exoc4	T	A	6: 33,332,283	M280K	probably damaging	Het
Fam122a	T	A	19: 24,477,086	M91L	probably benign	Het
Fam71e2	T	C	7: 4,770,678	T73A	probably damaging	Het
Fmo1	T	G	1: 162,851,410	E89A	probably benign	Het
Foxm1	A	G	6: 128,373,935	D733G	probably benign	Het
Gm10093	T	C	17: 78,492,287	S236P	probably damaging	Het
Gulp1	A	C	1: 44,754,351	R57S	probably damaging	Het
Hdac4	G	T	1: 92,030,154	A46E	probably benign	Het
Hspg2	T	C	4: 137,514,655	S567P	possibly damaging	Het
Iqgap1	A	C	7: 80,809,106	C21W	unknown	Het
Isoc2a	T	C	7: 4,891,489	L57P	probably damaging	Het
Krt34	G	A	11: 100,038,446	Q313*	probably null	Het
Krt6a	C	T	15: 101,692,573	V263I	probably damaging	Het
Man2a1	A	G	17: 64,733,724	I106V	possibly damaging	Het
Muc16	T	C	9: 18,558,379	D7300G	probably damaging	Het
Muc5b	A	T	7: 141,863,345	S3343C	possibly damaging	Het
Mup11	C	T	4: 60,662,240	E21K	possibly damaging	Het
Myo3b	T	A	2: 70,245,410		probably null	Het
Nlrp4c	T	C	7: 6,092,508	L795P	probably damaging	Het
Nup160	T	A	2: 90,717,876	Y984*	probably null	Het
Nwd1	C	T	8: 72,662,186	R81W	probably damaging	Het
Olfr472	A	G	7: 107,903,388	T224A	probably benign	Het
Olfr707	G	T	7: 106,891,928	Y60*	probably null	Het
Osmr	A	G	15: 6,860,352	V5A	probably benign	Het
Pcsk5	A	G	19: 17,836,953		probably null	Het
Pex11a	G	A	7: 79,737,379	T235M	probably damaging	Het
Pik3r6	A	G	11: 68,551,973	T730A	probably benign	Het
Ppp2r2d	T	C	7: 138,873,013	I41T	probably damaging	Het
Prdm1	C	T	10: 44,450,195	R126H	probably damaging	Het
Primpol	C	T	8: 46,586,442	R381H	probably benign	Het
Prl7a1	C	A	13: 27,637,643	Q102H	probably benign	Het
Rbpjl	T	C	2: 164,410,879	L284P	probably damaging	Het
Rgs21	A	T	1: 144,541,297	C6S	probably benign	Het
Rnasel	T	C	1: 153,754,392	V218A	probably benign	Het
Sag	G	T	1: 87,824,453	V223L	probably damaging	Het
Sdk1	C	T	5: 142,132,069	T1574M	probably damaging	Het
Secisbp2	G	A	13: 51,679,860	V679M	probably damaging	Het
Sele	T	A	1: 164,051,817		probably null	Het
Senp7	T	A	16: 56,169,754	L622M	probably damaging	Het
Sgo1	G	A	17: 53,676,953	R466C	probably damaging	Het
Sh3tc1	C	A	5: 35,706,246	V866L	probably benign	Het
Snrnp25	T	A	11: 32,207,647	V75D	probably benign	Het
Syne1	C	T	10: 5,061,429	C7899Y	probably damaging	Het
U2af1l4	T	C	7: 30,564,582	S55P	probably damaging	Het
Vmn1r23	A	G	6: 57,926,055	I246T	possibly damaging	Het
Vmn1r66	T	A	7: 10,274,402	R235*	probably null	Het
Wnk4	C	T	11: 101,275,068	A807V	possibly damaging	Het

Other mutations in Ppp1r9a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Ppp1r9a	APN	6	5158195	missense	possibly damaging	0.72
IGL00796:Ppp1r9a	APN	6	5157014	missense	probably benign	0.37
IGL00906:Ppp1r9a	APN	6	5157023	missense	possibly damaging	0.62
IGL01662:Ppp1r9a	APN	6	5115322	missense	probably damaging	1.00
IGL01695:Ppp1r9a	APN	6	5064003	missense	probably damaging	1.00
IGL01807:Ppp1r9a	APN	6	5158248	nonsense	probably null
IGL02126:Ppp1r9a	APN	6	5156229	missense	probably damaging	1.00
IGL02423:Ppp1r9a	APN	6	4906537	missense	probably benign	0.25
IGL03343:Ppp1r9a	APN	6	5046015	missense	probably damaging	1.00
IGL03365:Ppp1r9a	APN	6	5110993	splice site	probably benign
R0545:Ppp1r9a	UTSW	6	5115357	missense	probably benign	0.45
R1126:Ppp1r9a	UTSW	6	4906795	missense	possibly damaging	0.93
R1137:Ppp1r9a	UTSW	6	5159697	missense	possibly damaging	0.46
R1443:Ppp1r9a	UTSW	6	5057557	missense	probably damaging	1.00
R1484:Ppp1r9a	UTSW	6	5113712	nonsense	probably null
R1545:Ppp1r9a	UTSW	6	5156242	critical splice donor site	probably null
R1627:Ppp1r9a	UTSW	6	4906168	missense	possibly damaging	0.50
R1672:Ppp1r9a	UTSW	6	5143491	critical splice donor site	probably null
R1826:Ppp1r9a	UTSW	6	5111060	splice site	probably benign
R1834:Ppp1r9a	UTSW	6	5113710	missense	probably damaging	0.98
R1874:Ppp1r9a	UTSW	6	4906348	missense	possibly damaging	0.87
R2224:Ppp1r9a	UTSW	6	5154074	missense	probably benign
R2227:Ppp1r9a	UTSW	6	5154074	missense	probably benign
R2898:Ppp1r9a	UTSW	6	4906558	missense	probably benign	0.01
R3606:Ppp1r9a	UTSW	6	5113674	missense	possibly damaging	0.90
R3732:Ppp1r9a	UTSW	6	4906259	unclassified	probably benign
R3927:Ppp1r9a	UTSW	6	5057531	missense	probably damaging	1.00
R4631:Ppp1r9a	UTSW	6	4906537	missense	possibly damaging	0.62
R4682:Ppp1r9a	UTSW	6	4905477	missense	possibly damaging	0.48
R4766:Ppp1r9a	UTSW	6	5157016	missense	probably benign	0.11
R5197:Ppp1r9a	UTSW	6	5156177	missense	probably damaging	1.00
R5217:Ppp1r9a	UTSW	6	5115367	missense	probably damaging	1.00
R5493:Ppp1r9a	UTSW	6	5159702	missense	probably damaging	0.99
R5790:Ppp1r9a	UTSW	6	5134363	intron	probably benign
R5828:Ppp1r9a	UTSW	6	5158200	missense	probably damaging	1.00
R5896:Ppp1r9a	UTSW	6	5159648	missense	probably damaging	1.00
R5930:Ppp1r9a	UTSW	6	5157002	critical splice acceptor site	probably null
R5990:Ppp1r9a	UTSW	6	5134660	missense	probably benign	0.05
R6017:Ppp1r9a	UTSW	6	4906363	missense	probably benign	0.18
R6122:Ppp1r9a	UTSW	6	4905509	missense	probably damaging	1.00
R6175:Ppp1r9a	UTSW	6	4905639	nonsense	probably null
R6188:Ppp1r9a	UTSW	6	5158113	nonsense	probably null
R6233:Ppp1r9a	UTSW	6	5077610	missense	probably damaging	1.00
R6321:Ppp1r9a	UTSW	6	5115151	missense	probably damaging	1.00
R6449:Ppp1r9a	UTSW	6	5057458	missense	probably benign	0.44
R6454:Ppp1r9a	UTSW	6	4905827	missense	probably damaging	1.00
R6527:Ppp1r9a	UTSW	6	5045949	missense	probably damaging	1.00
R7053:Ppp1r9a	UTSW	6	4905670	missense	probably damaging	1.00
R7233:Ppp1r9a	UTSW	6	5134804	missense	probably benign
R7238:Ppp1r9a	UTSW	6	5159716	missense	probably damaging	1.00
R7438:Ppp1r9a	UTSW	6	5115378	missense	probably damaging	0.99
R7497:Ppp1r9a	UTSW	6	4905775	missense	probably damaging	1.00
R7666:Ppp1r9a	UTSW	6	5143238	missense	probably benign	0.00
R7698:Ppp1r9a	UTSW	6	4906430	missense	probably benign
R7850:Ppp1r9a	UTSW	6	4905894	missense	possibly damaging	0.77
R8029:Ppp1r9a	UTSW	6	5057518	missense	possibly damaging	0.76
R8392:Ppp1r9a	UTSW	6	5143491	critical splice donor site	probably null
R8411:Ppp1r9a	UTSW	6	5057568	missense	probably damaging	1.00
R8431:Ppp1r9a	UTSW	6	5115456	missense	probably benign	0.01
R8699:Ppp1r9a	UTSW	6	5115474	missense	probably benign	0.00
R8708:Ppp1r9a	UTSW	6	5115196	missense	probably damaging	1.00
R9039:Ppp1r9a	UTSW	6	5134657	missense	probably benign	0.00
R9096:Ppp1r9a	UTSW	6	4906012	missense	probably damaging	1.00
R9097:Ppp1r9a	UTSW	6	4906012	missense	probably damaging	1.00
R9131:Ppp1r9a	UTSW	6	5134106	missense	possibly damaging	0.86
R9279:Ppp1r9a	UTSW	6	5113757	missense	probably damaging	1.00
R9512:Ppp1r9a	UTSW	6	5113681	missense	probably benign	0.27
R9512:Ppp1r9a	UTSW	6	5115364	missense	probably damaging	0.99
R9567:Ppp1r9a	UTSW	6	5157004	missense	probably benign	0.34
R9672:Ppp1r9a	UTSW	6	5007889	missense	unknown
R9687:Ppp1r9a	UTSW	6	4905978	missense	probably damaging	1.00
R9715:Ppp1r9a	UTSW	6	5045936	missense	probably damaging	0.96
RF007:Ppp1r9a	UTSW	6	4906657	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGGAAAACAAACCGGAGATTTC -3'
(R):5'- TGCATTGCAGCAGGTTGTAATTAC -3'

Sequencing Primer
(F):5'- AAACCGGAGATTTCTGTGCC -3'
(R):5'- GCAGCAGGTTGTAATTACAAATGTC -3'

Posted On

2018-06-04