Incidental Mutation 'R6499:Inhbb'
ID519609
Institutional Source Beutler Lab
Gene Symbol Inhbb
Ensembl Gene ENSMUSG00000037035
Gene Nameinhibin beta-B
Synonymsactivin
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.665) question?
Stock #R6499 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location119415465-119422248 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119417339 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 407 (E407K)
Ref Sequence ENSEMBL: ENSMUSP00000044918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038765]
Predicted Effect probably damaging
Transcript: ENSMUST00000038765
AA Change: E407K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044918
Gene: ENSMUSG00000037035
AA Change: E407K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:TGFb_propeptide 66 282 1.4e-13 PFAM
TGFB 307 411 5.55e-53 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate a subunit of the dimeric activin and inhibin protein complexes. These complexes activate and inhibit, respectively, follicle stimulating hormone secretion from the pituitary gland. Homozygous knockout mice for this gene exhibit eyelid defects. [provided by RefSeq, Aug 2016]
PHENOTYPE: Some homozygotes for targeted null mutations exhibit open eyes at birth and impaired maternal nuturing. Mutant females for one line exhibit extended gestation length, retarded mammary duct elongation and alveolar morphogenesis, and are unable to nurse their pups. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Inhbb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02212:Inhbb APN 1 119417983 missense probably benign 0.33
R0091:Inhbb UTSW 1 119417395 missense probably damaging 1.00
R0609:Inhbb UTSW 1 119417416 missense probably damaging 1.00
R1352:Inhbb UTSW 1 119420695 missense probably benign 0.30
R2119:Inhbb UTSW 1 119420701 missense probably benign 0.04
R3964:Inhbb UTSW 1 119417561 missense probably damaging 1.00
R3966:Inhbb UTSW 1 119417561 missense probably damaging 1.00
R4996:Inhbb UTSW 1 119420818 missense probably damaging 1.00
R5709:Inhbb UTSW 1 119417530 missense probably damaging 0.97
R5973:Inhbb UTSW 1 119418076 missense possibly damaging 0.70
R6376:Inhbb UTSW 1 119417681 missense probably damaging 1.00
R6685:Inhbb UTSW 1 119417605 missense probably damaging 1.00
R7158:Inhbb UTSW 1 119421022 nonsense probably null
R7498:Inhbb UTSW 1 119417878 missense probably damaging 1.00
Z1176:Inhbb UTSW 1 119417798 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTAGGAGTCTCTCGTGCC -3'
(R):5'- TACGGGAACTACTGTGAGGG -3'

Sequencing Primer
(F):5'- TCGTGCCACAGAGGGATTCTC -3'
(R):5'- AACTACTGTGAGGGCAGCTGC -3'
Posted On2018-06-06