Incidental Mutation 'R6499:Inhbb'
ID 519609
Institutional Source Beutler Lab
Gene Symbol Inhbb
Ensembl Gene ENSMUSG00000037035
Gene Name inhibin beta-B
Synonyms activin beta-B
MMRRC Submission 044631-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.548) question?
Stock # R6499 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 119343195-119349978 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 119345069 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 407 (E407K)
Ref Sequence ENSEMBL: ENSMUSP00000044918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038765]
AlphaFold Q04999
Predicted Effect probably damaging
Transcript: ENSMUST00000038765
AA Change: E407K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044918
Gene: ENSMUSG00000037035
AA Change: E407K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:TGFb_propeptide 66 282 1.4e-13 PFAM
TGFB 307 411 5.55e-53 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: This gene encodes a member of the TGF-beta (transforming growth factor-beta) superfamily of proteins. The encoded preproprotein is proteolytically processed to generate a subunit of the dimeric activin and inhibin protein complexes. These complexes activate and inhibit, respectively, follicle stimulating hormone secretion from the pituitary gland. Homozygous knockout mice for this gene exhibit eyelid defects. [provided by RefSeq, Aug 2016]
PHENOTYPE: Some homozygotes for targeted null mutations exhibit open eyes at birth and impaired maternal nuturing. Mutant females for one line exhibit extended gestation length, retarded mammary duct elongation and alveolar morphogenesis, and are unable to nurse their pups. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,774,561 (GRCm39) T1250M probably damaging Het
Actn1 C T 12: 80,215,191 (GRCm39) A857T possibly damaging Het
Adam2 C T 14: 66,296,239 (GRCm39) V207I probably damaging Het
Angpt2 T C 8: 18,744,533 (GRCm39) T404A probably benign Het
Ank3 T C 10: 69,827,574 (GRCm39) probably benign Het
Atosa C A 9: 74,930,930 (GRCm39) Q958K probably damaging Het
B4galt4 T A 16: 38,578,184 (GRCm39) D210E probably benign Het
Brinp3 A T 1: 146,777,431 (GRCm39) H626L possibly damaging Het
Ccna2 T G 3: 36,625,112 (GRCm39) D68A probably damaging Het
Cd163 G A 6: 124,281,703 (GRCm39) G2D probably benign Het
Chrm5 A T 2: 112,310,825 (GRCm39) V97D probably benign Het
Dctn5 G A 7: 121,734,320 (GRCm39) V55I probably benign Het
Dnm3 A T 1: 162,141,164 (GRCm39) I365N probably damaging Het
Esyt2 A G 12: 116,284,790 (GRCm39) D184G probably damaging Het
Ifi214 C A 1: 173,352,597 (GRCm39) K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 (GRCm39) P169L probably benign Het
Lama2 T A 10: 26,907,154 (GRCm39) T2336S probably damaging Het
Ldhb A T 6: 142,439,847 (GRCm39) V231E possibly damaging Het
Lrit2 T C 14: 36,790,767 (GRCm39) F149L probably damaging Het
Malrd1 T A 2: 15,936,500 (GRCm39) S1575T probably benign Het
Naip5 A G 13: 100,358,102 (GRCm39) C1045R probably benign Het
Nefl A G 14: 68,322,034 (GRCm39) E208G probably damaging Het
Oog4 A C 4: 143,164,548 (GRCm39) S328A probably damaging Het
Or1e1 T A 11: 73,245,011 (GRCm39) L144Q probably damaging Het
Or5p79 G T 7: 108,221,713 (GRCm39) M231I probably benign Het
Or6c216 T C 10: 129,678,453 (GRCm39) I153V probably benign Het
Or7e168 A G 9: 19,719,847 (GRCm39) I78V probably benign Het
Pbrm1 A G 14: 30,783,466 (GRCm39) N528D probably damaging Het
Pls1 A G 9: 95,636,798 (GRCm39) I558T probably damaging Het
Polq T C 16: 36,881,189 (GRCm39) S839P probably benign Het
Psmg1 A G 16: 95,789,297 (GRCm39) F87L probably damaging Het
Ptprt A G 2: 161,376,507 (GRCm39) M1298T probably benign Het
Rbm27 T A 18: 42,470,076 (GRCm39) W958R probably damaging Het
Skint5 T G 4: 113,396,552 (GRCm39) D1207A unknown Het
Stx17 T A 4: 48,183,478 (GRCm39) probably null Het
Tas2r114 A T 6: 131,666,099 (GRCm39) *310R probably null Het
Tmem130 T A 5: 144,689,224 (GRCm39) N139I probably damaging Het
Trpc1 T C 9: 95,608,490 (GRCm39) E267G probably damaging Het
Trrap T A 5: 144,793,812 (GRCm39) M3398K probably damaging Het
Vrtn T G 12: 84,697,090 (GRCm39) D613E probably benign Het
Vsx1 G T 2: 150,530,441 (GRCm39) T147K probably benign Het
Wdr55 T C 18: 36,895,231 (GRCm39) V103A probably benign Het
Zfp712 A T 13: 67,200,400 (GRCm39) D28E probably benign Het
Other mutations in Inhbb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02212:Inhbb APN 1 119,345,713 (GRCm39) missense probably benign 0.33
R0091:Inhbb UTSW 1 119,345,125 (GRCm39) missense probably damaging 1.00
R0609:Inhbb UTSW 1 119,345,146 (GRCm39) missense probably damaging 1.00
R1352:Inhbb UTSW 1 119,348,425 (GRCm39) missense probably benign 0.30
R2119:Inhbb UTSW 1 119,348,431 (GRCm39) missense probably benign 0.04
R3964:Inhbb UTSW 1 119,345,291 (GRCm39) missense probably damaging 1.00
R3966:Inhbb UTSW 1 119,345,291 (GRCm39) missense probably damaging 1.00
R4996:Inhbb UTSW 1 119,348,548 (GRCm39) missense probably damaging 1.00
R5709:Inhbb UTSW 1 119,345,260 (GRCm39) missense probably damaging 0.97
R5973:Inhbb UTSW 1 119,345,806 (GRCm39) missense possibly damaging 0.70
R6376:Inhbb UTSW 1 119,345,411 (GRCm39) missense probably damaging 1.00
R6685:Inhbb UTSW 1 119,345,335 (GRCm39) missense probably damaging 1.00
R7158:Inhbb UTSW 1 119,348,752 (GRCm39) nonsense probably null
R7498:Inhbb UTSW 1 119,345,608 (GRCm39) missense probably damaging 1.00
R8920:Inhbb UTSW 1 119,345,107 (GRCm39) missense probably damaging 1.00
Z1176:Inhbb UTSW 1 119,345,528 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTAGGAGTCTCTCGTGCC -3'
(R):5'- TACGGGAACTACTGTGAGGG -3'

Sequencing Primer
(F):5'- TCGTGCCACAGAGGGATTCTC -3'
(R):5'- AACTACTGTGAGGGCAGCTGC -3'
Posted On 2018-06-06