Mutagenetix > Incidental Mutation

Incidental Mutation 'R6499:Brinp3'

519610

Institutional Source

Beutler Lab

Gene Symbol

Brinp3

Ensembl Gene

ENSMUSG00000035131

Gene Name

bone morphogenetic protein/retinoic acid inducible neural specific 3

Synonyms

Fam5c, B830045N13Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.260) question?

Stock #

R6499 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

146494760-146902472 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 146901693 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 626 (H626L)

Ref Sequence

ENSEMBL: ENSMUSP00000126074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000166814]

AlphaFold

Q499E0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000074622
AA Change: H626L

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: H626L

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128345

SMART Domains

Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166814
AA Change: H626L

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: H626L

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.7%

Validation Efficiency

98% (43/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	C	T	3: 138,068,800	T1250M	probably damaging	Het
Actn1	C	T	12: 80,168,417	A857T	possibly damaging	Het
Adam2	C	T	14: 66,058,790	V207I	probably damaging	Het
Angpt2	T	C	8: 18,694,517	T404A	probably benign	Het
Ank3	T	C	10: 69,991,744		probably benign	Het
B4galt4	T	A	16: 38,757,822	D210E	probably benign	Het
Ccna2	T	G	3: 36,570,963	D68A	probably damaging	Het
Cd163	G	A	6: 124,304,744	G2D	probably benign	Het
Chrm5	A	T	2: 112,480,480	V97D	probably benign	Het
Dctn5	G	A	7: 122,135,097	V55I	probably benign	Het
Dnm3	A	T	1: 162,313,595	I365N	probably damaging	Het
Esyt2	A	G	12: 116,321,170	D184G	probably damaging	Het
Fam214a	C	A	9: 75,023,648	Q958K	probably damaging	Het
Ifi214	C	A	1: 173,525,031	K277N	probably damaging	Het
Il11ra1	C	T	4: 41,765,412	P169L	probably benign	Het
Inhbb	C	T	1: 119,417,339	E407K	probably damaging	Het
Lama2	T	A	10: 27,031,158	T2336S	probably damaging	Het
Ldhb	A	T	6: 142,494,121	V231E	possibly damaging	Het
Lrit2	T	C	14: 37,068,810	F149L	probably damaging	Het
Malrd1	T	A	2: 15,931,689	S1575T	probably benign	Het
Naip5	A	G	13: 100,221,594	C1045R	probably benign	Het
Nefl	A	G	14: 68,084,585	E208G	probably damaging	Het
Olfr20	T	A	11: 73,354,185	L144Q	probably damaging	Het
Olfr507	G	T	7: 108,622,506	M231I	probably benign	Het
Olfr812	T	C	10: 129,842,584	I153V	probably benign	Het
Olfr859	A	G	9: 19,808,551	I78V	probably benign	Het
Oog4	A	C	4: 143,437,978	S328A	probably damaging	Het
Pbrm1	A	G	14: 31,061,509	N528D	probably damaging	Het
Pls1	A	G	9: 95,754,745	I558T	probably damaging	Het
Polq	T	C	16: 37,060,827	S839P	probably benign	Het
Psmg1	A	G	16: 95,988,097	F87L	probably damaging	Het
Ptprt	A	G	2: 161,534,587	M1298T	probably benign	Het
Rbm27	T	A	18: 42,337,011	W958R	probably damaging	Het
Skint5	T	G	4: 113,539,355	D1207A	unknown	Het
Stx17	T	A	4: 48,183,478		probably null	Het
Tas2r114	A	T	6: 131,689,136	*310R	probably null	Het
Tmem130	T	A	5: 144,752,414	N139I	probably damaging	Het
Trpc1	T	C	9: 95,726,437	E267G	probably damaging	Het
Trrap	T	A	5: 144,857,002	M3398K	probably damaging	Het
Vrtn	T	G	12: 84,650,316	D613E	probably benign	Het
Vsx1	G	T	2: 150,688,521	T147K	probably benign	Het
Wdr55	T	C	18: 36,762,178	V103A	probably benign	Het
Zfp712	A	T	13: 67,052,336	D28E	probably benign	Het

Other mutations in Brinp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Brinp3	APN	1	146901774	missense	probably damaging	0.99
IGL00503:Brinp3	APN	1	146901167	missense	probably benign
IGL01702:Brinp3	APN	1	146751997	splice site	probably benign
IGL01728:Brinp3	APN	1	146831551	splice site	probably null
IGL01733:Brinp3	APN	1	146514803	missense	probably benign	0.33
IGL01937:Brinp3	APN	1	146901140	missense	probably benign
IGL02020:Brinp3	APN	1	146902127	utr 3 prime	probably benign
IGL02082:Brinp3	APN	1	146751862	missense	probably damaging	1.00
IGL02365:Brinp3	APN	1	146901122	missense	probably benign	0.00
IGL02366:Brinp3	APN	1	146701743	missense	possibly damaging	0.84
IGL02565:Brinp3	APN	1	146902032	missense	probably damaging	0.98
IGL02999:Brinp3	APN	1	146701849	splice site	probably null
IGL03099:Brinp3	APN	1	146902097	missense	possibly damaging	0.91
PIT4283001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
PIT4418001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0266:Brinp3	UTSW	1	146682680	nonsense	probably null
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1522:Brinp3	UTSW	1	146901890	missense	probably damaging	0.99
R1596:Brinp3	UTSW	1	146514782	missense	probably benign
R1898:Brinp3	UTSW	1	146901249	missense	possibly damaging	0.93
R2036:Brinp3	UTSW	1	146701841	missense	possibly damaging	0.84
R2224:Brinp3	UTSW	1	146901920	nonsense	probably null
R2272:Brinp3	UTSW	1	146901404	missense	possibly damaging	0.93
R2291:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R2322:Brinp3	UTSW	1	146701754	missense	probably benign
R2880:Brinp3	UTSW	1	146902002	missense	probably damaging	0.98
R3918:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3939:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3940:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3941:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3942:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R4095:Brinp3	UTSW	1	146901692	missense	possibly damaging	0.72
R4783:Brinp3	UTSW	1	146727640	intron	probably benign
R5009:Brinp3	UTSW	1	146901049	missense	probably benign	0.25
R5034:Brinp3	UTSW	1	146727720	intron	probably benign
R5166:Brinp3	UTSW	1	146901367	missense	probably damaging	0.96
R5372:Brinp3	UTSW	1	146831726	missense	probably damaging	1.00
R5472:Brinp3	UTSW	1	146901459	missense	possibly damaging	0.86
R5651:Brinp3	UTSW	1	146701799	missense	probably benign	0.01
R5681:Brinp3	UTSW	1	146901746	missense	probably benign	0.12
R6351:Brinp3	UTSW	1	146901585	missense	probably damaging	0.96
R6470:Brinp3	UTSW	1	146901906	missense	probably damaging	0.99
R7078:Brinp3	UTSW	1	146514889	nonsense	probably null
R7223:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R7322:Brinp3	UTSW	1	146682688	nonsense	probably null
R7347:Brinp3	UTSW	1	146902086	missense	probably benign	0.22
R7375:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7412:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7532:Brinp3	UTSW	1	146901401	missense	probably damaging	0.98
R7562:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7576:Brinp3	UTSW	1	146901563	missense	probably damaging	0.99
R7723:Brinp3	UTSW	1	146701671	missense	probably damaging	1.00
R7737:Brinp3	UTSW	1	146682594	missense	probably damaging	0.98
R7793:Brinp3	UTSW	1	146746568	missense	probably benign	0.20
R8334:Brinp3	UTSW	1	146902053	missense	probably damaging	0.99
R8401:Brinp3	UTSW	1	146901446	missense	probably benign	0.17
R9205:Brinp3	UTSW	1	146902089	missense	possibly damaging	0.57
R9328:Brinp3	UTSW	1	146831717	missense	probably damaging	0.98
R9602:Brinp3	UTSW	1	146746496	missense	probably damaging	1.00
X0060:Brinp3	UTSW	1	146901786	missense	probably benign	0.01
Z1176:Brinp3	UTSW	1	146902076	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAACAGCACGTTGGAGCCAG -3'
(R):5'- CCTGGGATCCCTGAGTATAAGG -3'

Sequencing Primer
(F):5'- CAGTGCTGGCTGTTTATGTCAATCC -3'
(R):5'- GTAGTCCAGCTGCAAAATCAGGTC -3'

Posted On

2018-06-06