Incidental Mutation 'R6499:Malrd1'
ID 519612
Institutional Source Beutler Lab
Gene Symbol Malrd1
Ensembl Gene ENSMUSG00000075520
Gene Name MAM and LDL receptor class A domain containing 1
Synonyms Diet1, Gm13364, Gm13318
MMRRC Submission 044631-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R6499 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 15526479-16255555 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 15931689 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1575 (S1575T)
Ref Sequence ENSEMBL: ENSMUSP00000116869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146205]
AlphaFold A2AJX4
Predicted Effect probably benign
Transcript: ENSMUST00000146205
AA Change: S1575T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000116869
Gene: ENSMUSG00000075520
AA Change: S1575T

DomainStartEndE-ValueType
Pfam:MAM 8 171 1.6e-36 PFAM
LDLa 181 219 6.89e-8 SMART
LDLa 225 262 4.37e-10 SMART
LDLa 264 303 9.55e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 (GRCm38) T1250M probably damaging Het
Actn1 C T 12: 80,168,417 (GRCm38) A857T possibly damaging Het
Adam2 C T 14: 66,058,790 (GRCm38) V207I probably damaging Het
Angpt2 T C 8: 18,694,517 (GRCm38) T404A probably benign Het
Ank3 T C 10: 69,991,744 (GRCm38) probably benign Het
B4galt4 T A 16: 38,757,822 (GRCm38) D210E probably benign Het
Brinp3 A T 1: 146,901,693 (GRCm38) H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 (GRCm38) D68A probably damaging Het
Cd163 G A 6: 124,304,744 (GRCm38) G2D probably benign Het
Chrm5 A T 2: 112,480,480 (GRCm38) V97D probably benign Het
Dctn5 G A 7: 122,135,097 (GRCm38) V55I probably benign Het
Dnm3 A T 1: 162,313,595 (GRCm38) I365N probably damaging Het
Esyt2 A G 12: 116,321,170 (GRCm38) D184G probably damaging Het
Fam214a C A 9: 75,023,648 (GRCm38) Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 (GRCm38) K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 (GRCm38) P169L probably benign Het
Inhbb C T 1: 119,417,339 (GRCm38) E407K probably damaging Het
Lama2 T A 10: 27,031,158 (GRCm38) T2336S probably damaging Het
Ldhb A T 6: 142,494,121 (GRCm38) V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 (GRCm38) F149L probably damaging Het
Naip5 A G 13: 100,221,594 (GRCm38) C1045R probably benign Het
Nefl A G 14: 68,084,585 (GRCm38) E208G probably damaging Het
Olfr20 T A 11: 73,354,185 (GRCm38) L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 (GRCm38) M231I probably benign Het
Olfr812 T C 10: 129,842,584 (GRCm38) I153V probably benign Het
Olfr859 A G 9: 19,808,551 (GRCm38) I78V probably benign Het
Oog4 A C 4: 143,437,978 (GRCm38) S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 (GRCm38) N528D probably damaging Het
Pls1 A G 9: 95,754,745 (GRCm38) I558T probably damaging Het
Polq T C 16: 37,060,827 (GRCm38) S839P probably benign Het
Psmg1 A G 16: 95,988,097 (GRCm38) F87L probably damaging Het
Ptprt A G 2: 161,534,587 (GRCm38) M1298T probably benign Het
Rbm27 T A 18: 42,337,011 (GRCm38) W958R probably damaging Het
Skint5 T G 4: 113,539,355 (GRCm38) D1207A unknown Het
Stx17 T A 4: 48,183,478 (GRCm38) probably null Het
Tas2r114 A T 6: 131,689,136 (GRCm38) *310R probably null Het
Tmem130 T A 5: 144,752,414 (GRCm38) N139I probably damaging Het
Trpc1 T C 9: 95,726,437 (GRCm38) E267G probably damaging Het
Trrap T A 5: 144,857,002 (GRCm38) M3398K probably damaging Het
Vrtn T G 12: 84,650,316 (GRCm38) D613E probably benign Het
Vsx1 G T 2: 150,688,521 (GRCm38) T147K probably benign Het
Wdr55 T C 18: 36,762,178 (GRCm38) V103A probably benign Het
Zfp712 A T 13: 67,052,336 (GRCm38) D28E probably benign Het
Other mutations in Malrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Malrd1 APN 2 16,142,186 (GRCm38) splice site probably benign
IGL01295:Malrd1 APN 2 16,101,957 (GRCm38) critical splice donor site probably null
IGL01296:Malrd1 APN 2 16,101,957 (GRCm38) critical splice donor site probably null
IGL01399:Malrd1 APN 2 16,101,957 (GRCm38) critical splice donor site probably null
IGL01400:Malrd1 APN 2 16,101,957 (GRCm38) critical splice donor site probably null
IGL01401:Malrd1 APN 2 16,101,957 (GRCm38) critical splice donor site probably null
IGL01402:Malrd1 APN 2 16,101,957 (GRCm38) critical splice donor site probably null
IGL01405:Malrd1 APN 2 16,101,957 (GRCm38) critical splice donor site probably null
IGL01406:Malrd1 APN 2 16,101,957 (GRCm38) critical splice donor site probably null
IGL02105:Malrd1 APN 2 16,127,863 (GRCm38) missense unknown
IGL02581:Malrd1 APN 2 16,142,312 (GRCm38) nonsense probably null
IGL03015:Malrd1 APN 2 16,042,271 (GRCm38) missense unknown
IGL03038:Malrd1 APN 2 16,127,967 (GRCm38) missense unknown
R1353:Malrd1 UTSW 2 16,127,968 (GRCm38) missense unknown
R1385:Malrd1 UTSW 2 16,042,228 (GRCm38) missense unknown
R2242:Malrd1 UTSW 2 16,101,944 (GRCm38) missense unknown
R2888:Malrd1 UTSW 2 16,074,757 (GRCm38) missense unknown
R4398:Malrd1 UTSW 2 16,150,783 (GRCm38) missense unknown
R4982:Malrd1 UTSW 2 16,042,129 (GRCm38) missense probably benign 0.29
R5148:Malrd1 UTSW 2 16,142,226 (GRCm38) missense unknown
R5195:Malrd1 UTSW 2 16,150,810 (GRCm38) missense unknown
R5828:Malrd1 UTSW 2 15,526,653 (GRCm38) missense probably benign 0.00
R5892:Malrd1 UTSW 2 15,614,267 (GRCm38) missense probably benign 0.03
R6034:Malrd1 UTSW 2 15,845,326 (GRCm38) missense possibly damaging 0.78
R6034:Malrd1 UTSW 2 15,845,326 (GRCm38) missense possibly damaging 0.78
R6195:Malrd1 UTSW 2 15,695,326 (GRCm38) missense probably damaging 1.00
R6318:Malrd1 UTSW 2 16,042,267 (GRCm38) missense unknown
R6438:Malrd1 UTSW 2 15,614,206 (GRCm38) missense
R6457:Malrd1 UTSW 2 15,667,929 (GRCm38) missense probably benign 0.41
R6457:Malrd1 UTSW 2 15,526,597 (GRCm38) start gained probably benign
R6575:Malrd1 UTSW 2 15,842,628 (GRCm38) missense probably benign 0.00
R6792:Malrd1 UTSW 2 16,150,756 (GRCm38) missense unknown
R6796:Malrd1 UTSW 2 15,869,784 (GRCm38) missense unknown
R6930:Malrd1 UTSW 2 15,797,667 (GRCm38) missense unknown
R6959:Malrd1 UTSW 2 16,218,009 (GRCm38) missense probably damaging 0.97
R6993:Malrd1 UTSW 2 16,150,791 (GRCm38) missense unknown
R7102:Malrd1 UTSW 2 16,142,303 (GRCm38) missense unknown
R7112:Malrd1 UTSW 2 15,925,176 (GRCm38) missense unknown
R7248:Malrd1 UTSW 2 16,101,911 (GRCm38) missense unknown
R7249:Malrd1 UTSW 2 15,623,340 (GRCm38) missense probably damaging 0.97
R7334:Malrd1 UTSW 2 16,006,718 (GRCm38) missense probably damaging 0.99
R7394:Malrd1 UTSW 2 15,695,199 (GRCm38) missense unknown
R7399:Malrd1 UTSW 2 15,610,090 (GRCm38) missense
R7476:Malrd1 UTSW 2 16,142,304 (GRCm38) missense unknown
R7582:Malrd1 UTSW 2 15,695,270 (GRCm38) missense unknown
R7604:Malrd1 UTSW 2 15,925,192 (GRCm38) missense unknown
R7662:Malrd1 UTSW 2 15,871,454 (GRCm38) missense unknown
R7681:Malrd1 UTSW 2 16,218,102 (GRCm38) missense unknown
R7740:Malrd1 UTSW 2 15,614,215 (GRCm38) missense not run
R7747:Malrd1 UTSW 2 16,074,835 (GRCm38) missense unknown
R7754:Malrd1 UTSW 2 15,797,799 (GRCm38) splice site probably null
R7950:Malrd1 UTSW 2 16,128,068 (GRCm38) missense unknown
R8194:Malrd1 UTSW 2 15,925,120 (GRCm38) missense unknown
R8260:Malrd1 UTSW 2 15,614,206 (GRCm38) missense
R8314:Malrd1 UTSW 2 15,752,832 (GRCm38) missense unknown
R8342:Malrd1 UTSW 2 15,633,224 (GRCm38) missense unknown
R8386:Malrd1 UTSW 2 15,696,844 (GRCm38) missense unknown
R8492:Malrd1 UTSW 2 15,610,123 (GRCm38) missense
R8728:Malrd1 UTSW 2 15,696,942 (GRCm38) nonsense probably null
R8756:Malrd1 UTSW 2 15,752,895 (GRCm38) critical splice donor site probably null
R8869:Malrd1 UTSW 2 15,565,557 (GRCm38) critical splice donor site probably null
R8888:Malrd1 UTSW 2 15,845,227 (GRCm38) missense unknown
R8895:Malrd1 UTSW 2 15,845,227 (GRCm38) missense unknown
R8902:Malrd1 UTSW 2 16,255,334 (GRCm38) nonsense probably null
R8954:Malrd1 UTSW 2 15,551,367 (GRCm38) missense
R8960:Malrd1 UTSW 2 15,565,430 (GRCm38) nonsense probably null
R9005:Malrd1 UTSW 2 15,845,329 (GRCm38) missense unknown
R9135:Malrd1 UTSW 2 15,797,705 (GRCm38) missense unknown
R9267:Malrd1 UTSW 2 16,255,266 (GRCm38) missense unknown
R9330:Malrd1 UTSW 2 16,255,278 (GRCm38) missense unknown
R9359:Malrd1 UTSW 2 15,614,177 (GRCm38) missense
R9383:Malrd1 UTSW 2 15,695,201 (GRCm38) missense unknown
R9389:Malrd1 UTSW 2 15,703,156 (GRCm38) missense unknown
R9403:Malrd1 UTSW 2 15,614,177 (GRCm38) missense
R9454:Malrd1 UTSW 2 15,797,726 (GRCm38) nonsense probably null
R9454:Malrd1 UTSW 2 15,752,849 (GRCm38) missense unknown
R9520:Malrd1 UTSW 2 16,074,820 (GRCm38) missense unknown
R9544:Malrd1 UTSW 2 15,635,998 (GRCm38) missense unknown
R9609:Malrd1 UTSW 2 15,695,270 (GRCm38) missense unknown
R9667:Malrd1 UTSW 2 15,565,215 (GRCm38) critical splice acceptor site probably null
R9721:Malrd1 UTSW 2 15,696,827 (GRCm38) missense unknown
R9787:Malrd1 UTSW 2 15,620,590 (GRCm38) missense unknown
R9800:Malrd1 UTSW 2 15,842,594 (GRCm38) missense unknown
Z1176:Malrd1 UTSW 2 16,217,845 (GRCm38) missense unknown
Z1191:Malrd1 UTSW 2 16,042,226 (GRCm38) missense unknown
Predicted Primers PCR Primer
(F):5'- GCTAGAATAATCCCCTCATTGTTC -3'
(R):5'- GGACTGGAACTGTGATCTGTC -3'

Sequencing Primer
(F):5'- AGAATAATCCCCTCATTGTTCTTTTG -3'
(R):5'- GATCTGTCACTGCCCTCTATG -3'
Posted On 2018-06-06