Incidental Mutation 'R6499:Malrd1'
ID519612
Institutional Source Beutler Lab
Gene Symbol Malrd1
Ensembl Gene ENSMUSG00000075520
Gene NameMAM and LDL receptor class A domain containing 1
SynonymsDiet1, Gm13364, Gm13318
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R6499 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location15526479-16255555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15931689 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1575 (S1575T)
Ref Sequence ENSEMBL: ENSMUSP00000116869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146205]
Predicted Effect probably benign
Transcript: ENSMUST00000146205
AA Change: S1575T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000116869
Gene: ENSMUSG00000075520
AA Change: S1575T

DomainStartEndE-ValueType
Pfam:MAM 8 171 1.6e-36 PFAM
LDLa 181 219 6.89e-8 SMART
LDLa 225 262 4.37e-10 SMART
LDLa 264 303 9.55e-3 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Malrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Malrd1 APN 2 16142186 splice site probably benign
IGL01295:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01296:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01399:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01400:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01401:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01402:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01405:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL01406:Malrd1 APN 2 16101957 critical splice donor site probably null
IGL02105:Malrd1 APN 2 16127863 missense unknown
IGL02581:Malrd1 APN 2 16142312 nonsense probably null
IGL03015:Malrd1 APN 2 16042271 missense unknown
IGL03038:Malrd1 APN 2 16127967 missense unknown
R1353:Malrd1 UTSW 2 16127968 missense unknown
R1385:Malrd1 UTSW 2 16042228 missense unknown
R2242:Malrd1 UTSW 2 16101944 missense unknown
R2888:Malrd1 UTSW 2 16074757 missense unknown
R4398:Malrd1 UTSW 2 16150783 missense unknown
R4982:Malrd1 UTSW 2 16042129 missense probably benign 0.29
R5148:Malrd1 UTSW 2 16142226 missense unknown
R5195:Malrd1 UTSW 2 16150810 missense unknown
R5828:Malrd1 UTSW 2 15526653 missense probably benign 0.00
R5892:Malrd1 UTSW 2 15614267 missense probably benign 0.03
R6034:Malrd1 UTSW 2 15845326 missense possibly damaging 0.78
R6034:Malrd1 UTSW 2 15845326 missense possibly damaging 0.78
R6195:Malrd1 UTSW 2 15695326 missense probably damaging 1.00
R6318:Malrd1 UTSW 2 16042267 missense unknown
R6438:Malrd1 UTSW 2 15614206 missense
R6457:Malrd1 UTSW 2 15526597 start gained probably benign
R6457:Malrd1 UTSW 2 15667929 missense probably benign 0.41
R6575:Malrd1 UTSW 2 15842628 missense probably benign 0.00
R6792:Malrd1 UTSW 2 16150756 missense unknown
R6796:Malrd1 UTSW 2 15869784 missense unknown
R6930:Malrd1 UTSW 2 15797667 missense unknown
R6959:Malrd1 UTSW 2 16218009 missense probably damaging 0.97
R6993:Malrd1 UTSW 2 16150791 missense unknown
R7102:Malrd1 UTSW 2 16142303 missense unknown
R7112:Malrd1 UTSW 2 15925176 missense unknown
R7248:Malrd1 UTSW 2 16101911 missense unknown
R7249:Malrd1 UTSW 2 15623340 missense probably damaging 0.97
R7334:Malrd1 UTSW 2 16006718 missense probably damaging 0.99
R7394:Malrd1 UTSW 2 15695199 missense unknown
R7399:Malrd1 UTSW 2 15610090 missense
R7476:Malrd1 UTSW 2 16142304 missense unknown
R7582:Malrd1 UTSW 2 15695270 missense unknown
R7604:Malrd1 UTSW 2 15925192 missense unknown
R7662:Malrd1 UTSW 2 15871454 missense unknown
R7681:Malrd1 UTSW 2 16218102 missense unknown
R7740:Malrd1 UTSW 2 15614215 missense not run
R7747:Malrd1 UTSW 2 16074835 missense unknown
R7754:Malrd1 UTSW 2 15797799 splice site probably null
R8194:Malrd1 UTSW 2 15925120 missense unknown
R8260:Malrd1 UTSW 2 15614206 missense
R8314:Malrd1 UTSW 2 15752832 missense unknown
Z1176:Malrd1 UTSW 2 16217845 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTAGAATAATCCCCTCATTGTTC -3'
(R):5'- GGACTGGAACTGTGATCTGTC -3'

Sequencing Primer
(F):5'- AGAATAATCCCCTCATTGTTCTTTTG -3'
(R):5'- GATCTGTCACTGCCCTCTATG -3'
Posted On2018-06-06