Incidental Mutation 'R6499:Chrm5'
ID519613
Institutional Source Beutler Lab
Gene Symbol Chrm5
Ensembl Gene ENSMUSG00000074939
Gene Namecholinergic receptor, muscarinic 5
SynonymsM5R, muscarinic acetylcholine receptor 5
MMRRC Submission
Accession Numbers

Genbank: NM_205783; MGI: 109248

Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6499 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location112479171-112480769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112480480 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 97 (V97D)
Ref Sequence ENSEMBL: ENSMUSP00000097185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099589]
Predicted Effect probably benign
Transcript: ENSMUST00000099589
AA Change: V97D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097185
Gene: ENSMUSG00000074939
AA Change: V97D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 38 242 2.3e-8 PFAM
Pfam:7TM_GPCR_Srsx 41 253 7.5e-8 PFAM
Pfam:7tm_1 47 495 1.5e-79 PFAM
low complexity region 507 518 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The clinical implications of this receptor are unknown; however, stimulation of this receptor is known to increase cyclic AMP levels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit loss of acetylcholine-induced dilation of cerebral arteries, decreased pilocarpine-induced salivation, increased water-deprivation induced drinking, and attenuated morphine reinforcement and withdrawal. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(3)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Chrm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Chrm5 APN 2 112479232 missense probably benign
IGL01611:Chrm5 APN 2 112480306 nonsense probably null
IGL02152:Chrm5 APN 2 112480568 missense probably damaging 1.00
IGL03002:Chrm5 APN 2 112480361 missense probably damaging 1.00
C9142:Chrm5 UTSW 2 112480211 missense probably damaging 1.00
R0200:Chrm5 UTSW 2 112480720 missense probably benign
R0432:Chrm5 UTSW 2 112479655 missense possibly damaging 0.76
R1158:Chrm5 UTSW 2 112479869 missense probably benign 0.00
R1611:Chrm5 UTSW 2 112479187 missense possibly damaging 0.74
R1621:Chrm5 UTSW 2 112479837 missense probably benign 0.00
R1693:Chrm5 UTSW 2 112479280 missense probably damaging 1.00
R1988:Chrm5 UTSW 2 112480252 missense probably damaging 0.99
R1989:Chrm5 UTSW 2 112480252 missense probably damaging 0.99
R2071:Chrm5 UTSW 2 112479227 missense probably null 0.93
R2890:Chrm5 UTSW 2 112479703 missense probably benign 0.00
R4659:Chrm5 UTSW 2 112479757 missense probably benign
R4785:Chrm5 UTSW 2 112479585 missense probably benign 0.25
R5196:Chrm5 UTSW 2 112480384 missense probably damaging 1.00
R5734:Chrm5 UTSW 2 112480100 missense probably benign 0.28
R6343:Chrm5 UTSW 2 112479448 missense probably damaging 1.00
R6672:Chrm5 UTSW 2 112479796 missense probably benign
R6905:Chrm5 UTSW 2 112479556 missense probably benign 0.00
R7192:Chrm5 UTSW 2 112480327 missense probably damaging 0.97
R7775:Chrm5 UTSW 2 112479956 missense probably benign 0.07
R7778:Chrm5 UTSW 2 112479956 missense probably benign 0.07
X0023:Chrm5 UTSW 2 112480481 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCAAGCCGATCATGATGC -3'
(R):5'- TTTGGAACGCCATGGACTGTG -3'

Sequencing Primer
(F):5'- GATCATGATGCCAGCCCTC -3'
(R):5'- ACTATTGCAGCTGTGACCG -3'
Posted On2018-06-06