Incidental Mutation 'R6499:Vsx1'
ID 519614
Institutional Source Beutler Lab
Gene Symbol Vsx1
Ensembl Gene ENSMUSG00000033080
Gene Name visual system homeobox 1
Synonyms CHX10-like
MMRRC Submission 044631-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.197) question?
Stock # R6499 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 150522622-150531057 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 150530441 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 147 (T147K)
Ref Sequence ENSEMBL: ENSMUSP00000039088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046095]
AlphaFold Q91V10
Predicted Effect probably benign
Transcript: ENSMUST00000046095
AA Change: T147K

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000039088
Gene: ENSMUSG00000033080
AA Change: T147K

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 99 116 N/A INTRINSIC
HOX 171 233 1.63e-26 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a paired-like homeodomain and binds to the core of the locus control region of the red/green visual pigment gene cluster. The encoded protein may regulate expression of the cone opsin genes early in development. Mutations in this gene can cause posterior polymorphous corneal dystrophy and keratoconus. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutation of this locus impairs cone bipolar cell differentiation and affects retinal electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,774,561 (GRCm39) T1250M probably damaging Het
Actn1 C T 12: 80,215,191 (GRCm39) A857T possibly damaging Het
Adam2 C T 14: 66,296,239 (GRCm39) V207I probably damaging Het
Angpt2 T C 8: 18,744,533 (GRCm39) T404A probably benign Het
Ank3 T C 10: 69,827,574 (GRCm39) probably benign Het
Atosa C A 9: 74,930,930 (GRCm39) Q958K probably damaging Het
B4galt4 T A 16: 38,578,184 (GRCm39) D210E probably benign Het
Brinp3 A T 1: 146,777,431 (GRCm39) H626L possibly damaging Het
Ccna2 T G 3: 36,625,112 (GRCm39) D68A probably damaging Het
Cd163 G A 6: 124,281,703 (GRCm39) G2D probably benign Het
Chrm5 A T 2: 112,310,825 (GRCm39) V97D probably benign Het
Dctn5 G A 7: 121,734,320 (GRCm39) V55I probably benign Het
Dnm3 A T 1: 162,141,164 (GRCm39) I365N probably damaging Het
Esyt2 A G 12: 116,284,790 (GRCm39) D184G probably damaging Het
Ifi214 C A 1: 173,352,597 (GRCm39) K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 (GRCm39) P169L probably benign Het
Inhbb C T 1: 119,345,069 (GRCm39) E407K probably damaging Het
Lama2 T A 10: 26,907,154 (GRCm39) T2336S probably damaging Het
Ldhb A T 6: 142,439,847 (GRCm39) V231E possibly damaging Het
Lrit2 T C 14: 36,790,767 (GRCm39) F149L probably damaging Het
Malrd1 T A 2: 15,936,500 (GRCm39) S1575T probably benign Het
Naip5 A G 13: 100,358,102 (GRCm39) C1045R probably benign Het
Nefl A G 14: 68,322,034 (GRCm39) E208G probably damaging Het
Oog4 A C 4: 143,164,548 (GRCm39) S328A probably damaging Het
Or1e1 T A 11: 73,245,011 (GRCm39) L144Q probably damaging Het
Or5p79 G T 7: 108,221,713 (GRCm39) M231I probably benign Het
Or6c216 T C 10: 129,678,453 (GRCm39) I153V probably benign Het
Or7e168 A G 9: 19,719,847 (GRCm39) I78V probably benign Het
Pbrm1 A G 14: 30,783,466 (GRCm39) N528D probably damaging Het
Pls1 A G 9: 95,636,798 (GRCm39) I558T probably damaging Het
Polq T C 16: 36,881,189 (GRCm39) S839P probably benign Het
Psmg1 A G 16: 95,789,297 (GRCm39) F87L probably damaging Het
Ptprt A G 2: 161,376,507 (GRCm39) M1298T probably benign Het
Rbm27 T A 18: 42,470,076 (GRCm39) W958R probably damaging Het
Skint5 T G 4: 113,396,552 (GRCm39) D1207A unknown Het
Stx17 T A 4: 48,183,478 (GRCm39) probably null Het
Tas2r114 A T 6: 131,666,099 (GRCm39) *310R probably null Het
Tmem130 T A 5: 144,689,224 (GRCm39) N139I probably damaging Het
Trpc1 T C 9: 95,608,490 (GRCm39) E267G probably damaging Het
Trrap T A 5: 144,793,812 (GRCm39) M3398K probably damaging Het
Vrtn T G 12: 84,697,090 (GRCm39) D613E probably benign Het
Wdr55 T C 18: 36,895,231 (GRCm39) V103A probably benign Het
Zfp712 A T 13: 67,200,400 (GRCm39) D28E probably benign Het
Other mutations in Vsx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Vsx1 APN 2 150,530,447 (GRCm39) missense probably benign
IGL02216:Vsx1 APN 2 150,526,495 (GRCm39) missense possibly damaging 0.95
IGL03089:Vsx1 APN 2 150,527,510 (GRCm39) splice site probably benign
R1725:Vsx1 UTSW 2 150,528,120 (GRCm39) missense probably benign 0.41
R4619:Vsx1 UTSW 2 150,530,529 (GRCm39) missense probably benign
R5471:Vsx1 UTSW 2 150,524,986 (GRCm39) missense probably benign 0.06
R5956:Vsx1 UTSW 2 150,530,457 (GRCm39) missense possibly damaging 0.61
Z1177:Vsx1 UTSW 2 150,530,662 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTCCCACCTGCGGTAATG -3'
(R):5'- ATCCAACAGCGGAGATCCAG -3'

Sequencing Primer
(F):5'- ACCTGCGGTAATGGGGCTTG -3'
(R):5'- CCAGCGGAGGCAATAGGGTC -3'
Posted On 2018-06-06