Incidental Mutation 'R6499:Ccna2'
ID 519616
Institutional Source Beutler Lab
Gene Symbol Ccna2
Ensembl Gene ENSMUSG00000027715
Gene Name cyclin A2
Synonyms Ccn1, Ccna, Cyca, Ccn-1, CycA2
MMRRC Submission 044631-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6499 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 36619014-36626299 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 36625112 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 68 (D68A)
Ref Sequence ENSEMBL: ENSMUSP00000118239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029270] [ENSMUST00000040148] [ENSMUST00000108155] [ENSMUST00000108156] [ENSMUST00000147380] [ENSMUST00000196316]
AlphaFold P51943
Predicted Effect probably benign
Transcript: ENSMUST00000029270
AA Change: D68A

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000029270
Gene: ENSMUSG00000027715
AA Change: D68A

DomainStartEndE-ValueType
Pfam:Cyclin_N2 22 157 7.2e-50 PFAM
CYCLIN 206 290 1.07e-28 SMART
Cyclin_C 299 417 4.09e-31 SMART
CYCLIN 303 386 1.02e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040148
SMART Domains Protein: ENSMUSP00000047273
Gene: ENSMUSG00000037325

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108155
SMART Domains Protein: ENSMUSP00000103790
Gene: ENSMUSG00000037325

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108156
SMART Domains Protein: ENSMUSP00000103791
Gene: ENSMUSG00000037325

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145309
Predicted Effect probably damaging
Transcript: ENSMUST00000147380
AA Change: D68A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156575
Predicted Effect probably benign
Transcript: ENSMUST00000196316
SMART Domains Protein: ENSMUSP00000142946
Gene: ENSMUSG00000027715

DomainStartEndE-ValueType
CYCLIN 69 153 6.6e-31 SMART
Cyclin_C 162 280 2e-35 SMART
CYCLIN 166 249 6.1e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199136
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members function as regulators of the cell cycle. This protein binds and activates cyclin-dependent kinase 2 and thus promotes transition through G1/S and G2/M. [provided by RefSeq, Aug 2016]
PHENOTYPE: Embryos homozygous for a targeted mutation implant in the uterine wall, but fail to develop past 5.5 dpc. Notably, mutant embryos develop normally from the four-cell to the post-implantation stage in the absence of detectable maternally-derived gene products. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,774,561 (GRCm39) T1250M probably damaging Het
Actn1 C T 12: 80,215,191 (GRCm39) A857T possibly damaging Het
Adam2 C T 14: 66,296,239 (GRCm39) V207I probably damaging Het
Angpt2 T C 8: 18,744,533 (GRCm39) T404A probably benign Het
Ank3 T C 10: 69,827,574 (GRCm39) probably benign Het
Atosa C A 9: 74,930,930 (GRCm39) Q958K probably damaging Het
B4galt4 T A 16: 38,578,184 (GRCm39) D210E probably benign Het
Brinp3 A T 1: 146,777,431 (GRCm39) H626L possibly damaging Het
Cd163 G A 6: 124,281,703 (GRCm39) G2D probably benign Het
Chrm5 A T 2: 112,310,825 (GRCm39) V97D probably benign Het
Dctn5 G A 7: 121,734,320 (GRCm39) V55I probably benign Het
Dnm3 A T 1: 162,141,164 (GRCm39) I365N probably damaging Het
Esyt2 A G 12: 116,284,790 (GRCm39) D184G probably damaging Het
Ifi214 C A 1: 173,352,597 (GRCm39) K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 (GRCm39) P169L probably benign Het
Inhbb C T 1: 119,345,069 (GRCm39) E407K probably damaging Het
Lama2 T A 10: 26,907,154 (GRCm39) T2336S probably damaging Het
Ldhb A T 6: 142,439,847 (GRCm39) V231E possibly damaging Het
Lrit2 T C 14: 36,790,767 (GRCm39) F149L probably damaging Het
Malrd1 T A 2: 15,936,500 (GRCm39) S1575T probably benign Het
Naip5 A G 13: 100,358,102 (GRCm39) C1045R probably benign Het
Nefl A G 14: 68,322,034 (GRCm39) E208G probably damaging Het
Oog4 A C 4: 143,164,548 (GRCm39) S328A probably damaging Het
Or1e1 T A 11: 73,245,011 (GRCm39) L144Q probably damaging Het
Or5p79 G T 7: 108,221,713 (GRCm39) M231I probably benign Het
Or6c216 T C 10: 129,678,453 (GRCm39) I153V probably benign Het
Or7e168 A G 9: 19,719,847 (GRCm39) I78V probably benign Het
Pbrm1 A G 14: 30,783,466 (GRCm39) N528D probably damaging Het
Pls1 A G 9: 95,636,798 (GRCm39) I558T probably damaging Het
Polq T C 16: 36,881,189 (GRCm39) S839P probably benign Het
Psmg1 A G 16: 95,789,297 (GRCm39) F87L probably damaging Het
Ptprt A G 2: 161,376,507 (GRCm39) M1298T probably benign Het
Rbm27 T A 18: 42,470,076 (GRCm39) W958R probably damaging Het
Skint5 T G 4: 113,396,552 (GRCm39) D1207A unknown Het
Stx17 T A 4: 48,183,478 (GRCm39) probably null Het
Tas2r114 A T 6: 131,666,099 (GRCm39) *310R probably null Het
Tmem130 T A 5: 144,689,224 (GRCm39) N139I probably damaging Het
Trpc1 T C 9: 95,608,490 (GRCm39) E267G probably damaging Het
Trrap T A 5: 144,793,812 (GRCm39) M3398K probably damaging Het
Vrtn T G 12: 84,697,090 (GRCm39) D613E probably benign Het
Vsx1 G T 2: 150,530,441 (GRCm39) T147K probably benign Het
Wdr55 T C 18: 36,895,231 (GRCm39) V103A probably benign Het
Zfp712 A T 13: 67,200,400 (GRCm39) D28E probably benign Het
Other mutations in Ccna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1170:Ccna2 UTSW 3 36,623,119 (GRCm39) splice site probably benign
R1559:Ccna2 UTSW 3 36,624,879 (GRCm39) splice site probably benign
R2122:Ccna2 UTSW 3 36,622,875 (GRCm39) missense probably damaging 1.00
R3718:Ccna2 UTSW 3 36,620,387 (GRCm39) missense probably benign 0.14
R4749:Ccna2 UTSW 3 36,620,391 (GRCm39) missense probably benign 0.00
R5037:Ccna2 UTSW 3 36,625,152 (GRCm39) start gained probably benign
R7043:Ccna2 UTSW 3 36,624,302 (GRCm39) utr 5 prime probably benign
R7437:Ccna2 UTSW 3 36,625,239 (GRCm39) start gained probably benign
Z1177:Ccna2 UTSW 3 36,625,850 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTCCGGGTAAAGAGACAG -3'
(R):5'- TGTGAATCAGTTCTTTGCCCTAAC -3'

Sequencing Primer
(F):5'- CAGCTGCATTAAAAGCCAGGGC -3'
(R):5'- GAATCAGTTCTTTGCCCTAACTTTAG -3'
Posted On 2018-06-06