Incidental Mutation 'R6499:Ccna2'
ID519616
Institutional Source Beutler Lab
Gene Symbol Ccna2
Ensembl Gene ENSMUSG00000027715
Gene Namecyclin A2
SynonymsCycA2, Ccn-1, Ccna, Ccn1, Cyca
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6499 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location36564865-36572150 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 36570963 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 68 (D68A)
Ref Sequence ENSEMBL: ENSMUSP00000118239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029270] [ENSMUST00000040148] [ENSMUST00000108155] [ENSMUST00000108156] [ENSMUST00000147380] [ENSMUST00000196316]
Predicted Effect probably benign
Transcript: ENSMUST00000029270
AA Change: D68A

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000029270
Gene: ENSMUSG00000027715
AA Change: D68A

DomainStartEndE-ValueType
Pfam:Cyclin_N2 22 157 7.2e-50 PFAM
CYCLIN 206 290 1.07e-28 SMART
Cyclin_C 299 417 4.09e-31 SMART
CYCLIN 303 386 1.02e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040148
SMART Domains Protein: ENSMUSP00000047273
Gene: ENSMUSG00000037325

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108155
SMART Domains Protein: ENSMUSP00000103790
Gene: ENSMUSG00000037325

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108156
SMART Domains Protein: ENSMUSP00000103791
Gene: ENSMUSG00000037325

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
coiled coil region 330 365 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145309
Predicted Effect probably damaging
Transcript: ENSMUST00000147380
AA Change: D68A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156575
Predicted Effect probably benign
Transcript: ENSMUST00000196316
SMART Domains Protein: ENSMUSP00000142946
Gene: ENSMUSG00000027715

DomainStartEndE-ValueType
CYCLIN 69 153 6.6e-31 SMART
Cyclin_C 162 280 2e-35 SMART
CYCLIN 166 249 6.1e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199136
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members function as regulators of the cell cycle. This protein binds and activates cyclin-dependent kinase 2 and thus promotes transition through G1/S and G2/M. [provided by RefSeq, Aug 2016]
PHENOTYPE: Embryos homozygous for a targeted mutation implant in the uterine wall, but fail to develop past 5.5 dpc. Notably, mutant embryos develop normally from the four-cell to the post-implantation stage in the absence of detectable maternally-derived gene products. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Ccna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1170:Ccna2 UTSW 3 36568970 splice site probably benign
R1559:Ccna2 UTSW 3 36570730 splice site probably benign
R2122:Ccna2 UTSW 3 36568726 missense probably damaging 1.00
R3718:Ccna2 UTSW 3 36566238 missense probably benign 0.14
R4749:Ccna2 UTSW 3 36566242 missense probably benign 0.00
R5037:Ccna2 UTSW 3 36571003 start gained probably benign
R7043:Ccna2 UTSW 3 36570153 utr 5 prime probably benign
R7437:Ccna2 UTSW 3 36571090 start gained probably benign
Z1177:Ccna2 UTSW 3 36571701 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTCCGGGTAAAGAGACAG -3'
(R):5'- TGTGAATCAGTTCTTTGCCCTAAC -3'

Sequencing Primer
(F):5'- CAGCTGCATTAAAAGCCAGGGC -3'
(R):5'- GAATCAGTTCTTTGCCCTAACTTTAG -3'
Posted On2018-06-06