Incidental Mutation 'R6499:Il11ra1'
ID519619
Institutional Source Beutler Lab
Gene Symbol Il11ra1
Ensembl Gene ENSMUSG00000073889
Gene Nameinterleukin 11 receptor, alpha chain 1
SynonymsIl11ra, Il-11ra, NR1, Il-11ra-alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.828) question?
Stock #R6499 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location41699989-41769474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 41765412 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 169 (P169L)
Ref Sequence ENSEMBL: ENSMUSP00000103677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074387] [ENSMUST00000098132] [ENSMUST00000108033] [ENSMUST00000108035] [ENSMUST00000108036] [ENSMUST00000108037] [ENSMUST00000108040] [ENSMUST00000108041] [ENSMUST00000108042] [ENSMUST00000131349] [ENSMUST00000151142] [ENSMUST00000155322]
Predicted Effect probably benign
Transcript: ENSMUST00000074387
SMART Domains Protein: ENSMUSP00000073990
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCY 31 97 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098132
AA Change: P169L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095736
Gene: ENSMUSG00000073889
AA Change: P169L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108033
SMART Domains Protein: ENSMUSP00000103668
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SCY 30 96 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108035
SMART Domains Protein: ENSMUSP00000103670
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
SCY 38 104 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108036
SMART Domains Protein: ENSMUSP00000103671
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
SCY 75 141 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108037
SMART Domains Protein: ENSMUSP00000103672
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
SCY 75 141 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108040
AA Change: P169L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103675
Gene: ENSMUSG00000073889
AA Change: P169L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108041
AA Change: P169L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103676
Gene: ENSMUSG00000073889
AA Change: P169L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108042
AA Change: P169L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103677
Gene: ENSMUSG00000073889
AA Change: P169L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146608
Predicted Effect probably benign
Transcript: ENSMUST00000151142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152748
Predicted Effect probably benign
Transcript: ENSMUST00000155322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155538
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Female homozygotes for targeted null mutations are infertile due to defective decidua formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Il11ra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02681:Il11ra1 APN 4 41768552 missense possibly damaging 0.73
R0013:Il11ra1 UTSW 4 41765060 missense probably damaging 1.00
R0032:Il11ra1 UTSW 4 41768187 missense probably damaging 1.00
R0032:Il11ra1 UTSW 4 41768187 missense probably damaging 1.00
R0365:Il11ra1 UTSW 4 41767527 missense probably damaging 1.00
R0399:Il11ra1 UTSW 4 41766185 missense probably benign 0.03
R1585:Il11ra1 UTSW 4 41768207 missense probably damaging 0.98
R1591:Il11ra1 UTSW 4 41766200 missense probably damaging 1.00
R2424:Il11ra1 UTSW 4 41768222 missense probably damaging 1.00
R3037:Il11ra1 UTSW 4 41765074 missense possibly damaging 0.94
R4393:Il11ra1 UTSW 4 41768577 critical splice donor site probably null
R4770:Il11ra1 UTSW 4 41768187 missense probably damaging 1.00
R4798:Il11ra1 UTSW 4 41766096 unclassified probably benign
R5256:Il11ra1 UTSW 4 41767932 unclassified probably benign
R6005:Il11ra1 UTSW 4 41763887 critical splice donor site probably null
R6309:Il11ra1 UTSW 4 41765279 missense possibly damaging 0.87
R6833:Il11ra1 UTSW 4 41765454 missense probably benign 0.00
R6834:Il11ra1 UTSW 4 41765454 missense probably benign 0.00
R7015:Il11ra1 UTSW 4 41765421 missense probably benign 0.06
R7122:Il11ra1 UTSW 4 41766189 missense probably damaging 0.99
R7275:Il11ra1 UTSW 4 41765109 missense probably damaging 1.00
R7710:Il11ra1 UTSW 4 41764846 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCCTCCTAACCTCAGATGG -3'
(R):5'- AGCCATCTGTGACGACTCTG -3'

Sequencing Primer
(F):5'- GTAACCTTTTTACCAGGAAGAAGACG -3'
(R):5'- GTGACGACTCTGTCTTTATGAAAAGG -3'
Posted On2018-06-06