Incidental Mutation 'R6499:Stx17'
ID519620
Institutional Source Beutler Lab
Gene Symbol Stx17
Ensembl Gene ENSMUSG00000061455
Gene Namesyntaxin 17
Synonyms9030425C21Rik, 6330411F21Rik, 4833418L03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6499 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location48124915-48186507 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 48183478 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064765] [ENSMUST00000107720] [ENSMUST00000107721]
Predicted Effect probably benign
Transcript: ENSMUST00000064765
SMART Domains Protein: ENSMUSP00000068087
Gene: ENSMUSG00000061455

DomainStartEndE-ValueType
low complexity region 74 88 N/A INTRINSIC
t_SNARE 156 223 9.65e-13 SMART
transmembrane domain 228 250 N/A INTRINSIC
transmembrane domain 255 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107720
SMART Domains Protein: ENSMUSP00000103348
Gene: ENSMUSG00000061455

DomainStartEndE-ValueType
low complexity region 74 88 N/A INTRINSIC
t_SNARE 156 223 9.65e-13 SMART
transmembrane domain 228 250 N/A INTRINSIC
transmembrane domain 255 274 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107721
SMART Domains Protein: ENSMUSP00000103349
Gene: ENSMUSG00000061455

DomainStartEndE-ValueType
low complexity region 52 66 N/A INTRINSIC
t_SNARE 134 201 9.65e-13 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Stx17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stx17 APN 4 48158955 missense possibly damaging 0.72
IGL01625:Stx17 APN 4 48181526 missense probably damaging 1.00
IGL01975:Stx17 APN 4 48180670 missense probably damaging 1.00
R1977:Stx17 UTSW 4 48181553 missense probably benign 0.00
R2069:Stx17 UTSW 4 48158870 missense probably damaging 0.99
R4117:Stx17 UTSW 4 48180689 missense probably damaging 1.00
R4201:Stx17 UTSW 4 48158870 missense probably damaging 0.99
R4202:Stx17 UTSW 4 48158870 missense probably damaging 0.99
R5265:Stx17 UTSW 4 48183470 utr 3 prime probably benign
R5308:Stx17 UTSW 4 48182851 utr 3 prime probably benign
R6414:Stx17 UTSW 4 48158809 critical splice acceptor site probably null
R6969:Stx17 UTSW 4 48140462 missense probably damaging 1.00
R7062:Stx17 UTSW 4 48140442 missense probably benign 0.07
R7482:Stx17 UTSW 4 48181722 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGCATGTCAAACCTGAGCAG -3'
(R):5'- ACTTACTGATGGCACTTTGGG -3'

Sequencing Primer
(F):5'- GCAGGGGGCATTCAGAATG -3'
(R):5'- ACTGATGGCACTTTGGGGATTC -3'
Posted On2018-06-06