Incidental Mutation 'R6499:Oog4'
ID519622
Institutional Source Beutler Lab
Gene Symbol Oog4
Ensembl Gene ENSMUSG00000047799
Gene Nameoogenesin 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R6499 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location143437164-143450324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 143437978 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 328 (S328A)
Ref Sequence ENSEMBL: ENSMUSP00000073325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061277] [ENSMUST00000073641]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061277
AA Change: S256A

PolyPhen 2 Score 0.457 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052217
Gene: ENSMUSG00000047799
AA Change: S256A

DomainStartEndE-ValueType
SCOP:d1a4ya_ 195 357 6e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073641
AA Change: S328A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073325
Gene: ENSMUSG00000047799
AA Change: S328A

DomainStartEndE-ValueType
SCOP:d1a4ya_ 267 429 3e-7 SMART
Meta Mutation Damage Score 0.1648 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Oog4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01580:Oog4 APN 4 143439112 missense probably benign 0.27
IGL02207:Oog4 APN 4 143438940 missense probably benign 0.20
R0038:Oog4 UTSW 4 143438944 missense probably benign 0.20
R0038:Oog4 UTSW 4 143438944 missense probably benign 0.20
R0326:Oog4 UTSW 4 143439203 missense probably benign 0.03
R0372:Oog4 UTSW 4 143437689 missense probably damaging 1.00
R1056:Oog4 UTSW 4 143438011 missense possibly damaging 0.72
R1598:Oog4 UTSW 4 143438001 missense probably damaging 0.99
R1712:Oog4 UTSW 4 143439914 missense probably damaging 1.00
R4028:Oog4 UTSW 4 143440200 missense probably benign 0.02
R4029:Oog4 UTSW 4 143440200 missense probably benign 0.02
R4030:Oog4 UTSW 4 143440200 missense probably benign 0.02
R4705:Oog4 UTSW 4 143438875 missense probably benign 0.00
R5260:Oog4 UTSW 4 143437854 missense probably benign 0.00
R5945:Oog4 UTSW 4 143437723 missense probably benign 0.01
R6614:Oog4 UTSW 4 143437875 missense possibly damaging 0.66
R6852:Oog4 UTSW 4 143439109 missense possibly damaging 0.72
R7371:Oog4 UTSW 4 143438776 missense possibly damaging 0.47
R7375:Oog4 UTSW 4 143438974 missense possibly damaging 0.72
R7501:Oog4 UTSW 4 143437452 frame shift probably null
R7564:Oog4 UTSW 4 143437452 frame shift probably null
R7678:Oog4 UTSW 4 143437452 frame shift probably null
R7688:Oog4 UTSW 4 143437452 frame shift probably null
R7689:Oog4 UTSW 4 143437452 frame shift probably null
Z1177:Oog4 UTSW 4 143437574 missense possibly damaging 0.91
Z1177:Oog4 UTSW 4 143437575 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTTAGGGCAGGCAAAATGGC -3'
(R):5'- CAGACAACAGAAGGTCATGTCC -3'

Sequencing Primer
(F):5'- AATGGCACTGATCTGAGAGTCCTC -3'
(R):5'- TCATGTCCTGGGGCTTGACC -3'
Posted On2018-06-06