Incidental Mutation 'R6499:Tmem130'
ID519623
Institutional Source Beutler Lab
Gene Symbol Tmem130
Ensembl Gene ENSMUSG00000043388
Gene Nametransmembrane protein 130
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6499 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location144735915-144761818 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144752414 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 139 (N139I)
Ref Sequence ENSEMBL: ENSMUSP00000061100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061446]
Predicted Effect probably damaging
Transcript: ENSMUST00000061446
AA Change: N139I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061100
Gene: ENSMUSG00000043388
AA Change: N139I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PKD 140 226 6.04e-1 SMART
Blast:PKD 242 332 6e-22 BLAST
transmembrane domain 337 359 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197254
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Tmem130
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Tmem130 APN 5 144752445 missense probably damaging 0.99
IGL02808:Tmem130 APN 5 144743623 missense probably damaging 1.00
R0599:Tmem130 UTSW 5 144737809 missense probably damaging 1.00
R0714:Tmem130 UTSW 5 144737809 missense probably damaging 1.00
R1807:Tmem130 UTSW 5 144755364 missense probably benign 0.04
R1858:Tmem130 UTSW 5 144752283 splice site probably null
R1914:Tmem130 UTSW 5 144737856 missense probably damaging 1.00
R1915:Tmem130 UTSW 5 144737856 missense probably damaging 1.00
R2031:Tmem130 UTSW 5 144752426 missense possibly damaging 0.88
R2074:Tmem130 UTSW 5 144755274 missense possibly damaging 0.86
R2145:Tmem130 UTSW 5 144743785 missense probably benign 0.08
R2183:Tmem130 UTSW 5 144755432 missense possibly damaging 0.87
R3971:Tmem130 UTSW 5 144755321 missense probably benign 0.04
R5092:Tmem130 UTSW 5 144743718 missense probably benign 0.04
R5743:Tmem130 UTSW 5 144750939 missense probably damaging 0.99
R6151:Tmem130 UTSW 5 144737851 missense probably benign 0.41
R7124:Tmem130 UTSW 5 144750911 missense probably damaging 0.97
R7798:Tmem130 UTSW 5 144743770 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGAGCACTGACAGAGACAG -3'
(R):5'- ATCGAGATCCACTGGGTCTC -3'

Sequencing Primer
(F):5'- TCAGGTTACATACTGAGACCCTGG -3'
(R):5'- GTGAACTCAGGCTCTCTT -3'
Posted On2018-06-06