Incidental Mutation 'R6499:Ldhb'
ID519627
Institutional Source Beutler Lab
Gene Symbol Ldhb
Ensembl Gene ENSMUSG00000030246
Gene Namelactate dehydrogenase B
SynonymsLdh-2, lactate dehydrogenase-B, H-Ldh
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6499 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location142490249-142507957 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 142494121 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 231 (V231E)
Ref Sequence ENSEMBL: ENSMUSP00000032373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032373] [ENSMUST00000134191]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032373
AA Change: V231E

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032373
Gene: ENSMUSG00000030246
AA Change: V231E

DomainStartEndE-ValueType
Pfam:Ldh_1_N 22 161 4.2e-51 PFAM
Pfam:Ldh_1_C 164 334 9.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130817
Predicted Effect probably benign
Transcript: ENSMUST00000134191
SMART Domains Protein: ENSMUSP00000116014
Gene: ENSMUSG00000030246

DomainStartEndE-ValueType
Pfam:Ldh_1_N 22 161 6.3e-54 PFAM
Pfam:Glyco_hydro_4 79 178 2.1e-8 PFAM
Pfam:Ldh_1_C 164 198 1.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204433
AA Change: V164E

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: This gene encodes the B subunit of lactate dehydrogenase enzyme, which catalyzes the interconversion of pyruvate and lactate with concomitant interconversion of NADH and NAD+ in a post-glycolysis process. Alternatively spliced transcript variants have also been found for this gene. Recent studies have shown that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is localized in the peroxisomes. Pseudogenes have been identified on chromosomes 1 and 19. [provided by RefSeq, Feb 2016]
PHENOTYPE: Electrophoretic variants of LDHB are determined by: the a allele with fast anodal mobility in all inbred strains tested; and the b allele with slower mobility in Peru-Coppock stock. Three additional variants are known in wild M. spretus from southern France and Spain. Alleles are codominant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Ldhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02133:Ldhb APN 6 142492500 missense probably benign 0.16
IGL02215:Ldhb APN 6 142495566 critical splice donor site probably null
IGL03094:Ldhb APN 6 142505527 missense probably benign 0.00
IGL03337:Ldhb APN 6 142494156 missense probably benign
R0347:Ldhb UTSW 6 142494133 missense probably benign 0.00
R0703:Ldhb UTSW 6 142495601 missense probably damaging 1.00
R1531:Ldhb UTSW 6 142501395 missense probably benign 0.09
R1577:Ldhb UTSW 6 142492598 missense possibly damaging 0.87
R1844:Ldhb UTSW 6 142494208 missense probably damaging 1.00
R2151:Ldhb UTSW 6 142498670 missense possibly damaging 0.76
R3500:Ldhb UTSW 6 142501447 missense probably damaging 1.00
R4502:Ldhb UTSW 6 142490457 missense possibly damaging 0.60
R5139:Ldhb UTSW 6 142494195 missense probably damaging 1.00
R5214:Ldhb UTSW 6 142495595 missense probably damaging 1.00
R6525:Ldhb UTSW 6 142490465 missense probably benign
R6598:Ldhb UTSW 6 142490600 missense possibly damaging 0.56
R7096:Ldhb UTSW 6 142501373 missense probably benign 0.09
R7399:Ldhb UTSW 6 142495673 missense probably damaging 0.99
R7565:Ldhb UTSW 6 142492519 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGTCTCTACATTTGCCGGG -3'
(R):5'- ACTCTACCAGGGACAATTGCC -3'

Sequencing Primer
(F):5'- GGTTTTCCCCTGAGAACACAC -3'
(R):5'- TCTACCAGGGACAATTGCCATTAG -3'
Posted On2018-06-06