Incidental Mutation 'R6499:Olfr507'
ID519628
Institutional Source Beutler Lab
Gene Symbol Olfr507
Ensembl Gene ENSMUSG00000061000
Gene Nameolfactory receptor 507
SynonymsGA_x6K02T2PBJ9-10951546-10952496, MOR204-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R6499 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location108621814-108622764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108622506 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 231 (M231I)
Ref Sequence ENSEMBL: ENSMUSP00000078926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080014]
Predicted Effect probably benign
Transcript: ENSMUST00000080014
AA Change: M231I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000078926
Gene: ENSMUSG00000061000
AA Change: M231I

DomainStartEndE-ValueType
Pfam:7tm_4 34 313 6.1e-52 PFAM
Pfam:7tm_1 44 295 1e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Olfr507
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Olfr507 APN 7 108621857 missense probably damaging 1.00
IGL01979:Olfr507 APN 7 108622441 missense probably benign 0.09
IGL02373:Olfr507 APN 7 108622103 missense probably benign 0.11
IGL02754:Olfr507 APN 7 108622673 missense possibly damaging 0.94
IGL03008:Olfr507 APN 7 108622283 missense probably damaging 0.99
R0305:Olfr507 UTSW 7 108622585 missense probably benign 0.01
R0584:Olfr507 UTSW 7 108622415 missense probably benign 0.00
R0611:Olfr507 UTSW 7 108622287 missense possibly damaging 0.72
R0947:Olfr507 UTSW 7 108622672 missense probably benign 0.02
R1488:Olfr507 UTSW 7 108622489 missense probably damaging 1.00
R1808:Olfr507 UTSW 7 108622610 missense possibly damaging 0.87
R3763:Olfr507 UTSW 7 108622717 missense probably damaging 1.00
R4367:Olfr507 UTSW 7 108621889 missense probably benign 0.27
R4369:Olfr507 UTSW 7 108621889 missense probably benign 0.27
R4371:Olfr507 UTSW 7 108621889 missense probably benign 0.27
R4609:Olfr507 UTSW 7 108622504 missense probably benign 0.35
R5389:Olfr507 UTSW 7 108622717 missense probably damaging 1.00
R6684:Olfr507 UTSW 7 108621934 missense probably damaging 0.98
R7531:Olfr507 UTSW 7 108622062 missense probably benign 0.06
R7555:Olfr507 UTSW 7 108622726 missense probably damaging 1.00
R7893:Olfr507 UTSW 7 108622637 missense probably damaging 1.00
R7976:Olfr507 UTSW 7 108622637 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATCCAGTTGCTAGTGGGATC -3'
(R):5'- CATGGGGATTGCTATCGCTATC -3'

Sequencing Primer
(F):5'- CTCTTCTGTGGACCAAATAAAGTC -3'
(R):5'- GCTATCGCTATCATGTAAAACACAG -3'
Posted On2018-06-06