Incidental Mutation 'R6499:Dctn5'
ID 519629
Institutional Source Beutler Lab
Gene Symbol Dctn5
Ensembl Gene ENSMUSG00000030868
Gene Name dynactin 5
Synonyms 4930427E12Rik, p25 dynactin subunit, b2b315Clo
MMRRC Submission 044631-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6499 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 121732264-121748267 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 121734320 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 55 (V55I)
Ref Sequence ENSEMBL: ENSMUSP00000033156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033156] [ENSMUST00000063587] [ENSMUST00000098068] [ENSMUST00000106468] [ENSMUST00000106469] [ENSMUST00000142952] [ENSMUST00000176193]
AlphaFold Q9QZB9
Predicted Effect probably benign
Transcript: ENSMUST00000033156
AA Change: V55I

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000033156
Gene: ENSMUSG00000030868
AA Change: V55I

DomainStartEndE-ValueType
Pfam:Hexapep 84 118 1.3e-6 PFAM
Pfam:Hexapep 100 130 7.5e-7 PFAM
Pfam:Hexapep 107 142 7.7e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063587
SMART Domains Protein: ENSMUSP00000063514
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
PDB:3EU7|A 36 383 N/A PDB
SCOP:d2bbkh_ 231 381 4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098068
SMART Domains Protein: ENSMUSP00000095675
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 415 431 N/A INTRINSIC
low complexity region 446 462 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
Pfam:PALB2_WD40 755 1102 2.4e-183 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106468
SMART Domains Protein: ENSMUSP00000102076
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 415 431 N/A INTRINSIC
low complexity region 446 462 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
low complexity region 543 559 N/A INTRINSIC
PDB:3EU7|A 753 984 1e-131 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000106469
SMART Domains Protein: ENSMUSP00000102077
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 180 196 N/A INTRINSIC
PDB:3EU7|A 390 740 N/A PDB
SCOP:d2bbkh_ 588 738 3e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130149
SMART Domains Protein: ENSMUSP00000121994
Gene: ENSMUSG00000044702

DomainStartEndE-ValueType
coiled coil region 9 46 N/A INTRINSIC
low complexity region 415 431 N/A INTRINSIC
low complexity region 446 462 N/A INTRINSIC
low complexity region 469 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132811
Predicted Effect probably benign
Transcript: ENSMUST00000142952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205352
Predicted Effect probably benign
Transcript: ENSMUST00000176193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162843
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of dynactin, a component of the cytoplasmic dynein motor machinery involved in minus-end-directed transport. The encoded protein is a component of the pointed-end subcomplex and is thought to bind membranous cargo. A pseudogene of this gene is located on the long arm of chromosome 1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit double outlet right ventricle (DORV), overriding aorta, and ventricular septal defect (VSD). Micrognathia, microcephaly/anencephaly and holoprosencephaly are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,774,561 (GRCm39) T1250M probably damaging Het
Actn1 C T 12: 80,215,191 (GRCm39) A857T possibly damaging Het
Adam2 C T 14: 66,296,239 (GRCm39) V207I probably damaging Het
Angpt2 T C 8: 18,744,533 (GRCm39) T404A probably benign Het
Ank3 T C 10: 69,827,574 (GRCm39) probably benign Het
Atosa C A 9: 74,930,930 (GRCm39) Q958K probably damaging Het
B4galt4 T A 16: 38,578,184 (GRCm39) D210E probably benign Het
Brinp3 A T 1: 146,777,431 (GRCm39) H626L possibly damaging Het
Ccna2 T G 3: 36,625,112 (GRCm39) D68A probably damaging Het
Cd163 G A 6: 124,281,703 (GRCm39) G2D probably benign Het
Chrm5 A T 2: 112,310,825 (GRCm39) V97D probably benign Het
Dnm3 A T 1: 162,141,164 (GRCm39) I365N probably damaging Het
Esyt2 A G 12: 116,284,790 (GRCm39) D184G probably damaging Het
Ifi214 C A 1: 173,352,597 (GRCm39) K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 (GRCm39) P169L probably benign Het
Inhbb C T 1: 119,345,069 (GRCm39) E407K probably damaging Het
Lama2 T A 10: 26,907,154 (GRCm39) T2336S probably damaging Het
Ldhb A T 6: 142,439,847 (GRCm39) V231E possibly damaging Het
Lrit2 T C 14: 36,790,767 (GRCm39) F149L probably damaging Het
Malrd1 T A 2: 15,936,500 (GRCm39) S1575T probably benign Het
Naip5 A G 13: 100,358,102 (GRCm39) C1045R probably benign Het
Nefl A G 14: 68,322,034 (GRCm39) E208G probably damaging Het
Oog4 A C 4: 143,164,548 (GRCm39) S328A probably damaging Het
Or1e1 T A 11: 73,245,011 (GRCm39) L144Q probably damaging Het
Or5p79 G T 7: 108,221,713 (GRCm39) M231I probably benign Het
Or6c216 T C 10: 129,678,453 (GRCm39) I153V probably benign Het
Or7e168 A G 9: 19,719,847 (GRCm39) I78V probably benign Het
Pbrm1 A G 14: 30,783,466 (GRCm39) N528D probably damaging Het
Pls1 A G 9: 95,636,798 (GRCm39) I558T probably damaging Het
Polq T C 16: 36,881,189 (GRCm39) S839P probably benign Het
Psmg1 A G 16: 95,789,297 (GRCm39) F87L probably damaging Het
Ptprt A G 2: 161,376,507 (GRCm39) M1298T probably benign Het
Rbm27 T A 18: 42,470,076 (GRCm39) W958R probably damaging Het
Skint5 T G 4: 113,396,552 (GRCm39) D1207A unknown Het
Stx17 T A 4: 48,183,478 (GRCm39) probably null Het
Tas2r114 A T 6: 131,666,099 (GRCm39) *310R probably null Het
Tmem130 T A 5: 144,689,224 (GRCm39) N139I probably damaging Het
Trpc1 T C 9: 95,608,490 (GRCm39) E267G probably damaging Het
Trrap T A 5: 144,793,812 (GRCm39) M3398K probably damaging Het
Vrtn T G 12: 84,697,090 (GRCm39) D613E probably benign Het
Vsx1 G T 2: 150,530,441 (GRCm39) T147K probably benign Het
Wdr55 T C 18: 36,895,231 (GRCm39) V103A probably benign Het
Zfp712 A T 13: 67,200,400 (GRCm39) D28E probably benign Het
Other mutations in Dctn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00548:Dctn5 APN 7 121,743,019 (GRCm39) nonsense probably null
IGL02110:Dctn5 APN 7 121,734,374 (GRCm39) missense probably damaging 1.00
IGL03102:Dctn5 APN 7 121,732,382 (GRCm39) missense probably benign
R4458:Dctn5 UTSW 7 121,734,303 (GRCm39) missense probably damaging 1.00
R5437:Dctn5 UTSW 7 121,732,552 (GRCm39) utr 3 prime probably benign
R5540:Dctn5 UTSW 7 121,734,275 (GRCm39) missense probably benign 0.19
R6027:Dctn5 UTSW 7 121,732,564 (GRCm39) splice site probably benign
R6112:Dctn5 UTSW 7 121,732,460 (GRCm39) unclassified probably benign
R8049:Dctn5 UTSW 7 121,732,466 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCTGAACAGAATGCAGTGGC -3'
(R):5'- ACTGTGAGCGCTTATGCAG -3'

Sequencing Primer
(F):5'- CAGTGGCAGATTGTTCTCTGTGC -3'
(R):5'- TTATGCAGCGCCCCCAAATG -3'
Posted On 2018-06-06