Incidental Mutation 'R6499:Angpt2'
ID 519630
Institutional Source Beutler Lab
Gene Symbol Angpt2
Ensembl Gene ENSMUSG00000031465
Gene Name angiopoietin 2
Synonyms Ang-2, Ang2
MMRRC Submission 044631-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.828) question?
Stock # R6499 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 18740279-18791578 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18744533 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 404 (T404A)
Ref Sequence ENSEMBL: ENSMUSP00000033846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033846] [ENSMUST00000039412] [ENSMUST00000124910]
AlphaFold O35608
Predicted Effect probably benign
Transcript: ENSMUST00000033846
AA Change: T404A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033846
Gene: ENSMUSG00000031465
AA Change: T404A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
coiled coil region 166 248 N/A INTRINSIC
FBG 279 494 9.43e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039412
SMART Domains Protein: ENSMUSP00000037000
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
coiled coil region 128 155 N/A INTRINSIC
Pfam:Microcephalin 224 597 1.2e-143 PFAM
BRCT 624 707 2.23e-2 SMART
BRCT 740 810 1.55e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124910
SMART Domains Protein: ENSMUSP00000131698
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170200
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: This gene encodes an endothelial cell (EC)-derived regulator of angiogenesis and ligand for endothelial-specific receptor tyrosine kinase. The encoded protein acts as an anti-apoptotic factor for stressed ECs and a proapoptotic factor for resting ECs. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous inactivation of this gene results in impaired angiogenesis, abnormal lymphatic development and function, and ultimately postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,774,561 (GRCm39) T1250M probably damaging Het
Actn1 C T 12: 80,215,191 (GRCm39) A857T possibly damaging Het
Adam2 C T 14: 66,296,239 (GRCm39) V207I probably damaging Het
Ank3 T C 10: 69,827,574 (GRCm39) probably benign Het
Atosa C A 9: 74,930,930 (GRCm39) Q958K probably damaging Het
B4galt4 T A 16: 38,578,184 (GRCm39) D210E probably benign Het
Brinp3 A T 1: 146,777,431 (GRCm39) H626L possibly damaging Het
Ccna2 T G 3: 36,625,112 (GRCm39) D68A probably damaging Het
Cd163 G A 6: 124,281,703 (GRCm39) G2D probably benign Het
Chrm5 A T 2: 112,310,825 (GRCm39) V97D probably benign Het
Dctn5 G A 7: 121,734,320 (GRCm39) V55I probably benign Het
Dnm3 A T 1: 162,141,164 (GRCm39) I365N probably damaging Het
Esyt2 A G 12: 116,284,790 (GRCm39) D184G probably damaging Het
Ifi214 C A 1: 173,352,597 (GRCm39) K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 (GRCm39) P169L probably benign Het
Inhbb C T 1: 119,345,069 (GRCm39) E407K probably damaging Het
Lama2 T A 10: 26,907,154 (GRCm39) T2336S probably damaging Het
Ldhb A T 6: 142,439,847 (GRCm39) V231E possibly damaging Het
Lrit2 T C 14: 36,790,767 (GRCm39) F149L probably damaging Het
Malrd1 T A 2: 15,936,500 (GRCm39) S1575T probably benign Het
Naip5 A G 13: 100,358,102 (GRCm39) C1045R probably benign Het
Nefl A G 14: 68,322,034 (GRCm39) E208G probably damaging Het
Oog4 A C 4: 143,164,548 (GRCm39) S328A probably damaging Het
Or1e1 T A 11: 73,245,011 (GRCm39) L144Q probably damaging Het
Or5p79 G T 7: 108,221,713 (GRCm39) M231I probably benign Het
Or6c216 T C 10: 129,678,453 (GRCm39) I153V probably benign Het
Or7e168 A G 9: 19,719,847 (GRCm39) I78V probably benign Het
Pbrm1 A G 14: 30,783,466 (GRCm39) N528D probably damaging Het
Pls1 A G 9: 95,636,798 (GRCm39) I558T probably damaging Het
Polq T C 16: 36,881,189 (GRCm39) S839P probably benign Het
Psmg1 A G 16: 95,789,297 (GRCm39) F87L probably damaging Het
Ptprt A G 2: 161,376,507 (GRCm39) M1298T probably benign Het
Rbm27 T A 18: 42,470,076 (GRCm39) W958R probably damaging Het
Skint5 T G 4: 113,396,552 (GRCm39) D1207A unknown Het
Stx17 T A 4: 48,183,478 (GRCm39) probably null Het
Tas2r114 A T 6: 131,666,099 (GRCm39) *310R probably null Het
Tmem130 T A 5: 144,689,224 (GRCm39) N139I probably damaging Het
Trpc1 T C 9: 95,608,490 (GRCm39) E267G probably damaging Het
Trrap T A 5: 144,793,812 (GRCm39) M3398K probably damaging Het
Vrtn T G 12: 84,697,090 (GRCm39) D613E probably benign Het
Vsx1 G T 2: 150,530,441 (GRCm39) T147K probably benign Het
Wdr55 T C 18: 36,895,231 (GRCm39) V103A probably benign Het
Zfp712 A T 13: 67,200,400 (GRCm39) D28E probably benign Het
Other mutations in Angpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Angpt2 APN 8 18,760,544 (GRCm39) missense probably benign 0.01
IGL01449:Angpt2 APN 8 18,760,641 (GRCm39) missense probably benign 0.01
IGL03088:Angpt2 APN 8 18,791,039 (GRCm39) missense probably benign 0.09
P0037:Angpt2 UTSW 8 18,764,259 (GRCm39) unclassified probably benign
R0308:Angpt2 UTSW 8 18,742,141 (GRCm39) missense possibly damaging 0.93
R1099:Angpt2 UTSW 8 18,749,149 (GRCm39) missense probably damaging 1.00
R1113:Angpt2 UTSW 8 18,742,134 (GRCm39) nonsense probably null
R1264:Angpt2 UTSW 8 18,791,233 (GRCm39) missense probably benign 0.00
R1308:Angpt2 UTSW 8 18,742,134 (GRCm39) nonsense probably null
R1518:Angpt2 UTSW 8 18,755,855 (GRCm39) missense probably benign 0.00
R1595:Angpt2 UTSW 8 18,748,129 (GRCm39) missense probably damaging 1.00
R2016:Angpt2 UTSW 8 18,755,747 (GRCm39) missense probably damaging 0.96
R2017:Angpt2 UTSW 8 18,755,747 (GRCm39) missense probably damaging 0.96
R2050:Angpt2 UTSW 8 18,755,673 (GRCm39) missense probably benign
R2142:Angpt2 UTSW 8 18,764,156 (GRCm39) missense probably benign 0.39
R2184:Angpt2 UTSW 8 18,742,132 (GRCm39) missense probably benign 0.00
R3028:Angpt2 UTSW 8 18,753,560 (GRCm39) missense probably benign 0.01
R4096:Angpt2 UTSW 8 18,748,111 (GRCm39) missense probably damaging 0.97
R4112:Angpt2 UTSW 8 18,749,139 (GRCm39) missense probably damaging 1.00
R4738:Angpt2 UTSW 8 18,791,075 (GRCm39) missense probably benign 0.07
R4790:Angpt2 UTSW 8 18,764,098 (GRCm39) missense probably damaging 1.00
R4935:Angpt2 UTSW 8 18,742,131 (GRCm39) missense probably damaging 1.00
R6056:Angpt2 UTSW 8 18,748,132 (GRCm39) missense probably benign 0.00
R6938:Angpt2 UTSW 8 18,748,105 (GRCm39) nonsense probably null
R7211:Angpt2 UTSW 8 18,791,147 (GRCm39) missense probably benign
R7323:Angpt2 UTSW 8 18,755,840 (GRCm39) missense probably benign 0.13
R7349:Angpt2 UTSW 8 18,742,090 (GRCm39) missense probably damaging 0.99
R7746:Angpt2 UTSW 8 18,742,080 (GRCm39) missense probably damaging 1.00
R7812:Angpt2 UTSW 8 18,742,161 (GRCm39) missense probably benign 0.43
R8346:Angpt2 UTSW 8 18,791,135 (GRCm39) nonsense probably null
R8348:Angpt2 UTSW 8 18,791,135 (GRCm39) nonsense probably null
R8508:Angpt2 UTSW 8 18,791,135 (GRCm39) nonsense probably null
R8509:Angpt2 UTSW 8 18,791,135 (GRCm39) nonsense probably null
R9138:Angpt2 UTSW 8 18,764,162 (GRCm39) missense probably benign 0.06
R9182:Angpt2 UTSW 8 18,760,658 (GRCm39) critical splice acceptor site probably null
R9211:Angpt2 UTSW 8 18,748,078 (GRCm39) missense probably benign 0.01
R9309:Angpt2 UTSW 8 18,749,172 (GRCm39) missense probably damaging 1.00
R9476:Angpt2 UTSW 8 18,764,143 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAGTCGTCTATGCTAGGCAG -3'
(R):5'- TTGTCATGAAAACATCCCTCCC -3'

Sequencing Primer
(F):5'- GCTGCTTCTTGCCAATTCAAATAGG -3'
(R):5'- AGTTGGTTCCTGTTTATACCAGTAC -3'
Posted On 2018-06-06