Incidental Mutation 'R6499:Angpt2'
ID519630
Institutional Source Beutler Lab
Gene Symbol Angpt2
Ensembl Gene ENSMUSG00000031465
Gene Nameangiopoietin 2
SynonymsAng2, Ang-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock #R6499 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location18690263-18741562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18694517 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 404 (T404A)
Ref Sequence ENSEMBL: ENSMUSP00000033846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033846] [ENSMUST00000039412] [ENSMUST00000124910]
Predicted Effect probably benign
Transcript: ENSMUST00000033846
AA Change: T404A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033846
Gene: ENSMUSG00000031465
AA Change: T404A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
coiled coil region 166 248 N/A INTRINSIC
FBG 279 494 9.43e-129 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039412
SMART Domains Protein: ENSMUSP00000037000
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
coiled coil region 128 155 N/A INTRINSIC
Pfam:Microcephalin 224 597 1.2e-143 PFAM
BRCT 624 707 2.23e-2 SMART
BRCT 740 810 1.55e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124910
SMART Domains Protein: ENSMUSP00000131698
Gene: ENSMUSG00000039842

DomainStartEndE-ValueType
BRCT 13 89 2.64e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170200
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: This gene encodes an endothelial cell (EC)-derived regulator of angiogenesis and ligand for endothelial-specific receptor tyrosine kinase. The encoded protein acts as an anti-apoptotic factor for stressed ECs and a proapoptotic factor for resting ECs. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous inactivation of this gene results in impaired angiogenesis, abnormal lymphatic development and function, and ultimately postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Angpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Angpt2 APN 8 18710528 missense probably benign 0.01
IGL01449:Angpt2 APN 8 18710625 missense probably benign 0.01
IGL03088:Angpt2 APN 8 18741023 missense probably benign 0.09
P0037:Angpt2 UTSW 8 18714243 unclassified probably benign
R0308:Angpt2 UTSW 8 18692125 missense possibly damaging 0.93
R1099:Angpt2 UTSW 8 18699133 missense probably damaging 1.00
R1113:Angpt2 UTSW 8 18692118 nonsense probably null
R1264:Angpt2 UTSW 8 18741217 missense probably benign 0.00
R1308:Angpt2 UTSW 8 18692118 nonsense probably null
R1518:Angpt2 UTSW 8 18705839 missense probably benign 0.00
R1595:Angpt2 UTSW 8 18698113 missense probably damaging 1.00
R2016:Angpt2 UTSW 8 18705731 missense probably damaging 0.96
R2017:Angpt2 UTSW 8 18705731 missense probably damaging 0.96
R2050:Angpt2 UTSW 8 18705657 missense probably benign
R2142:Angpt2 UTSW 8 18714140 missense probably benign 0.39
R2184:Angpt2 UTSW 8 18692116 missense probably benign 0.00
R3028:Angpt2 UTSW 8 18703544 missense probably benign 0.01
R4096:Angpt2 UTSW 8 18698095 missense probably damaging 0.97
R4112:Angpt2 UTSW 8 18699123 missense probably damaging 1.00
R4738:Angpt2 UTSW 8 18741059 missense probably benign 0.07
R4790:Angpt2 UTSW 8 18714082 missense probably damaging 1.00
R4935:Angpt2 UTSW 8 18692115 missense probably damaging 1.00
R6056:Angpt2 UTSW 8 18698116 missense probably benign 0.00
R6938:Angpt2 UTSW 8 18698089 nonsense probably null
R7211:Angpt2 UTSW 8 18741131 missense probably benign
R7323:Angpt2 UTSW 8 18705824 missense probably benign 0.13
R7349:Angpt2 UTSW 8 18692074 missense probably damaging 0.99
R7746:Angpt2 UTSW 8 18692064 missense probably damaging 1.00
R7812:Angpt2 UTSW 8 18692145 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CAGTCGTCTATGCTAGGCAG -3'
(R):5'- TTGTCATGAAAACATCCCTCCC -3'

Sequencing Primer
(F):5'- GCTGCTTCTTGCCAATTCAAATAGG -3'
(R):5'- AGTTGGTTCCTGTTTATACCAGTAC -3'
Posted On2018-06-06