Incidental Mutation 'R6499:Lama2'
ID 519635
Institutional Source Beutler Lab
Gene Symbol Lama2
Ensembl Gene ENSMUSG00000019899
Gene Name laminin, alpha 2
Synonyms mer, merosin
MMRRC Submission 044631-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.320) question?
Stock # R6499 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 26857281-27493021 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 26907154 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 2336 (T2336S)
Ref Sequence ENSEMBL: ENSMUSP00000090304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092639]
AlphaFold no structure available at present
PDB Structure LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR [X-RAY DIFFRACTION]
LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR, CA1 SITE MUTANT [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE FIFTH LAMININ G-LIKE MODULE OF THE MOUSE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE LG1-3 REGION OF THE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000092639
AA Change: T2336S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899
AA Change: T2336S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 5.35e-129 SMART
EGF_Lam 283 337 2.11e-4 SMART
EGF_Lam 340 407 1.59e-8 SMART
EGF_Lam 410 462 5.44e-7 SMART
EGF_Lam 465 511 9.05e-4 SMART
LamB 574 706 2.26e-44 SMART
Pfam:Laminin_EGF 715 745 2.8e-4 PFAM
EGF_Lam 753 800 4.03e-10 SMART
EGF_Lam 803 858 3.01e-9 SMART
EGF_Lam 861 911 1.35e-11 SMART
EGF_Lam 914 960 7.23e-12 SMART
EGF_Lam 963 1007 5.87e-12 SMART
EGF_Lam 1010 1053 1.28e-12 SMART
EGF_Lam 1056 1099 2.37e-7 SMART
EGF_Lam 1102 1159 3.22e-9 SMART
LamB 1225 1360 1.95e-57 SMART
EGF_like 1364 1413 8.13e-1 SMART
EGF_Lam 1416 1462 5.48e-12 SMART
EGF_Lam 1465 1520 1.27e-7 SMART
EGF_Lam 1523 1567 2.4e-8 SMART
Pfam:Laminin_I 1584 1849 2e-92 PFAM
Blast:MA 1881 2113 1e-112 BLAST
LamG 2162 2307 1.28e-25 SMART
LamG 2356 2500 2.2e-33 SMART
LamG 2542 2688 3.31e-28 SMART
low complexity region 2725 2741 N/A INTRINSIC
LamG 2781 2914 2.25e-39 SMART
LamG 2956 3092 1.53e-32 SMART
Predicted Effect unknown
Transcript: ENSMUST00000219763
AA Change: T348S
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,774,561 (GRCm39) T1250M probably damaging Het
Actn1 C T 12: 80,215,191 (GRCm39) A857T possibly damaging Het
Adam2 C T 14: 66,296,239 (GRCm39) V207I probably damaging Het
Angpt2 T C 8: 18,744,533 (GRCm39) T404A probably benign Het
Ank3 T C 10: 69,827,574 (GRCm39) probably benign Het
Atosa C A 9: 74,930,930 (GRCm39) Q958K probably damaging Het
B4galt4 T A 16: 38,578,184 (GRCm39) D210E probably benign Het
Brinp3 A T 1: 146,777,431 (GRCm39) H626L possibly damaging Het
Ccna2 T G 3: 36,625,112 (GRCm39) D68A probably damaging Het
Cd163 G A 6: 124,281,703 (GRCm39) G2D probably benign Het
Chrm5 A T 2: 112,310,825 (GRCm39) V97D probably benign Het
Dctn5 G A 7: 121,734,320 (GRCm39) V55I probably benign Het
Dnm3 A T 1: 162,141,164 (GRCm39) I365N probably damaging Het
Esyt2 A G 12: 116,284,790 (GRCm39) D184G probably damaging Het
Ifi214 C A 1: 173,352,597 (GRCm39) K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 (GRCm39) P169L probably benign Het
Inhbb C T 1: 119,345,069 (GRCm39) E407K probably damaging Het
Ldhb A T 6: 142,439,847 (GRCm39) V231E possibly damaging Het
Lrit2 T C 14: 36,790,767 (GRCm39) F149L probably damaging Het
Malrd1 T A 2: 15,936,500 (GRCm39) S1575T probably benign Het
Naip5 A G 13: 100,358,102 (GRCm39) C1045R probably benign Het
Nefl A G 14: 68,322,034 (GRCm39) E208G probably damaging Het
Oog4 A C 4: 143,164,548 (GRCm39) S328A probably damaging Het
Or1e1 T A 11: 73,245,011 (GRCm39) L144Q probably damaging Het
Or5p79 G T 7: 108,221,713 (GRCm39) M231I probably benign Het
Or6c216 T C 10: 129,678,453 (GRCm39) I153V probably benign Het
Or7e168 A G 9: 19,719,847 (GRCm39) I78V probably benign Het
Pbrm1 A G 14: 30,783,466 (GRCm39) N528D probably damaging Het
Pls1 A G 9: 95,636,798 (GRCm39) I558T probably damaging Het
Polq T C 16: 36,881,189 (GRCm39) S839P probably benign Het
Psmg1 A G 16: 95,789,297 (GRCm39) F87L probably damaging Het
Ptprt A G 2: 161,376,507 (GRCm39) M1298T probably benign Het
Rbm27 T A 18: 42,470,076 (GRCm39) W958R probably damaging Het
Skint5 T G 4: 113,396,552 (GRCm39) D1207A unknown Het
Stx17 T A 4: 48,183,478 (GRCm39) probably null Het
Tas2r114 A T 6: 131,666,099 (GRCm39) *310R probably null Het
Tmem130 T A 5: 144,689,224 (GRCm39) N139I probably damaging Het
Trpc1 T C 9: 95,608,490 (GRCm39) E267G probably damaging Het
Trrap T A 5: 144,793,812 (GRCm39) M3398K probably damaging Het
Vrtn T G 12: 84,697,090 (GRCm39) D613E probably benign Het
Vsx1 G T 2: 150,530,441 (GRCm39) T147K probably benign Het
Wdr55 T C 18: 36,895,231 (GRCm39) V103A probably benign Het
Zfp712 A T 13: 67,200,400 (GRCm39) D28E probably benign Het
Other mutations in Lama2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Lama2 APN 10 27,064,261 (GRCm39) missense probably benign 0.01
IGL00467:Lama2 APN 10 27,343,193 (GRCm39) splice site probably benign
IGL00470:Lama2 APN 10 27,119,738 (GRCm39) missense probably benign 0.22
IGL00517:Lama2 APN 10 27,073,326 (GRCm39) missense probably benign 0.01
IGL00541:Lama2 APN 10 27,064,302 (GRCm39) missense probably benign 0.14
IGL00931:Lama2 APN 10 26,882,772 (GRCm39) missense possibly damaging 0.92
IGL00951:Lama2 APN 10 26,906,281 (GRCm39) missense probably benign 0.03
IGL00988:Lama2 APN 10 27,245,011 (GRCm39) nonsense probably null
IGL01098:Lama2 APN 10 26,907,108 (GRCm39) missense possibly damaging 0.66
IGL01152:Lama2 APN 10 27,084,425 (GRCm39) missense probably benign 0.00
IGL01293:Lama2 APN 10 27,107,632 (GRCm39) missense probably benign 0.38
IGL01338:Lama2 APN 10 27,064,268 (GRCm39) missense probably benign 0.13
IGL01609:Lama2 APN 10 27,220,417 (GRCm39) missense probably benign 0.03
IGL01643:Lama2 APN 10 26,946,368 (GRCm39) splice site probably benign
IGL01675:Lama2 APN 10 27,064,050 (GRCm39) missense possibly damaging 0.77
IGL01681:Lama2 APN 10 27,141,041 (GRCm39) missense probably benign 0.33
IGL01694:Lama2 APN 10 26,882,738 (GRCm39) missense possibly damaging 0.75
IGL01705:Lama2 APN 10 27,065,270 (GRCm39) splice site probably benign
IGL01885:Lama2 APN 10 26,981,135 (GRCm39) nonsense probably null
IGL01935:Lama2 APN 10 27,298,600 (GRCm39) missense probably damaging 0.98
IGL01994:Lama2 APN 10 27,343,199 (GRCm39) critical splice donor site probably null
IGL02041:Lama2 APN 10 26,860,322 (GRCm39) missense probably damaging 1.00
IGL02067:Lama2 APN 10 27,052,792 (GRCm39) missense probably benign 0.02
IGL02097:Lama2 APN 10 27,014,956 (GRCm39) missense probably benign 0.09
IGL02179:Lama2 APN 10 26,946,360 (GRCm39) missense probably benign 0.01
IGL02268:Lama2 APN 10 26,877,112 (GRCm39) splice site probably benign
IGL02302:Lama2 APN 10 27,088,039 (GRCm39) missense probably benign 0.06
IGL02363:Lama2 APN 10 27,242,062 (GRCm39) missense probably damaging 1.00
IGL02378:Lama2 APN 10 26,919,652 (GRCm39) missense probably damaging 0.99
IGL02642:Lama2 APN 10 27,343,269 (GRCm39) missense probably damaging 1.00
IGL02676:Lama2 APN 10 26,994,489 (GRCm39) missense probably benign 0.00
IGL02695:Lama2 APN 10 26,876,771 (GRCm39) missense probably benign
IGL02735:Lama2 APN 10 26,980,124 (GRCm39) missense probably damaging 1.00
IGL02794:Lama2 APN 10 26,917,227 (GRCm39) missense possibly damaging 0.73
IGL02823:Lama2 APN 10 26,877,141 (GRCm39) missense probably damaging 1.00
IGL02869:Lama2 APN 10 26,891,534 (GRCm39) missense probably damaging 0.99
IGL02942:Lama2 APN 10 26,917,216 (GRCm39) missense probably damaging 1.00
IGL03201:Lama2 APN 10 27,220,566 (GRCm39) nonsense probably null
IGL03268:Lama2 APN 10 27,298,649 (GRCm39) missense probably damaging 1.00
IGL03288:Lama2 APN 10 27,245,047 (GRCm39) missense probably damaging 1.00
IGL03380:Lama2 APN 10 26,926,261 (GRCm39) missense probably damaging 1.00
IGL03407:Lama2 APN 10 27,223,017 (GRCm39) missense probably damaging 1.00
cowboy UTSW 10 26,919,639 (GRCm39) frame shift probably null
petri UTSW 10 26,869,394 (GRCm39) splice site probably null
PIT4362001:Lama2 UTSW 10 27,245,132 (GRCm39) missense probably damaging 1.00
PIT4382001:Lama2 UTSW 10 27,080,901 (GRCm39) missense probably damaging 1.00
PIT4431001:Lama2 UTSW 10 26,977,426 (GRCm39) missense probably damaging 1.00
R0038:Lama2 UTSW 10 26,862,793 (GRCm39) missense probably benign 0.02
R0038:Lama2 UTSW 10 26,862,793 (GRCm39) missense probably benign 0.02
R0114:Lama2 UTSW 10 26,869,064 (GRCm39) nonsense probably null
R0142:Lama2 UTSW 10 27,063,841 (GRCm39) missense probably benign
R0313:Lama2 UTSW 10 26,869,394 (GRCm39) splice site probably null
R0376:Lama2 UTSW 10 26,891,542 (GRCm39) missense possibly damaging 0.68
R0412:Lama2 UTSW 10 27,066,621 (GRCm39) missense possibly damaging 0.58
R0472:Lama2 UTSW 10 26,866,863 (GRCm39) missense probably damaging 1.00
R0607:Lama2 UTSW 10 27,065,127 (GRCm39) missense probably benign 0.34
R0648:Lama2 UTSW 10 26,865,372 (GRCm39) missense probably benign 0.00
R0667:Lama2 UTSW 10 27,220,406 (GRCm39) splice site probably null
R0760:Lama2 UTSW 10 26,920,429 (GRCm39) critical splice donor site probably null
R1240:Lama2 UTSW 10 26,917,120 (GRCm39) missense probably damaging 1.00
R1385:Lama2 UTSW 10 27,100,039 (GRCm39) missense probably benign 0.11
R1433:Lama2 UTSW 10 27,063,750 (GRCm39) missense probably damaging 1.00
R1434:Lama2 UTSW 10 27,084,366 (GRCm39) missense probably damaging 1.00
R1574:Lama2 UTSW 10 27,200,750 (GRCm39) missense possibly damaging 0.65
R1574:Lama2 UTSW 10 27,200,750 (GRCm39) missense possibly damaging 0.65
R1645:Lama2 UTSW 10 27,244,981 (GRCm39) missense probably damaging 1.00
R1702:Lama2 UTSW 10 27,066,525 (GRCm39) missense probably benign
R1703:Lama2 UTSW 10 27,142,667 (GRCm39) missense probably damaging 1.00
R1769:Lama2 UTSW 10 27,084,403 (GRCm39) missense probably benign
R1769:Lama2 UTSW 10 27,084,402 (GRCm39) missense probably damaging 1.00
R1846:Lama2 UTSW 10 27,088,092 (GRCm39) missense probably damaging 1.00
R1859:Lama2 UTSW 10 26,907,078 (GRCm39) missense possibly damaging 0.51
R1871:Lama2 UTSW 10 26,860,490 (GRCm39) missense probably damaging 1.00
R1903:Lama2 UTSW 10 27,064,395 (GRCm39) missense probably damaging 1.00
R1906:Lama2 UTSW 10 26,932,523 (GRCm39) critical splice donor site probably null
R1958:Lama2 UTSW 10 26,857,594 (GRCm39) missense probably damaging 0.97
R1959:Lama2 UTSW 10 27,298,614 (GRCm39) missense probably damaging 1.00
R1977:Lama2 UTSW 10 26,866,796 (GRCm39) splice site probably null
R2063:Lama2 UTSW 10 27,040,922 (GRCm39) missense probably damaging 1.00
R2079:Lama2 UTSW 10 27,245,049 (GRCm39) missense probably damaging 0.99
R2085:Lama2 UTSW 10 27,080,837 (GRCm39) nonsense probably null
R2125:Lama2 UTSW 10 26,920,449 (GRCm39) nonsense probably null
R2140:Lama2 UTSW 10 26,930,690 (GRCm39) splice site probably null
R2219:Lama2 UTSW 10 26,919,565 (GRCm39) missense probably damaging 0.99
R2259:Lama2 UTSW 10 26,907,123 (GRCm39) missense probably benign 0.00
R2265:Lama2 UTSW 10 26,868,932 (GRCm39) missense probably damaging 1.00
R2266:Lama2 UTSW 10 26,862,793 (GRCm39) missense probably benign 0.02
R2267:Lama2 UTSW 10 26,868,932 (GRCm39) missense probably damaging 1.00
R2268:Lama2 UTSW 10 26,868,932 (GRCm39) missense probably damaging 1.00
R2269:Lama2 UTSW 10 26,868,932 (GRCm39) missense probably damaging 1.00
R2862:Lama2 UTSW 10 27,298,608 (GRCm39) nonsense probably null
R2912:Lama2 UTSW 10 26,876,799 (GRCm39) missense probably benign
R2999:Lama2 UTSW 10 26,865,417 (GRCm39) missense probably benign 0.18
R3034:Lama2 UTSW 10 26,877,231 (GRCm39) missense probably benign 0.11
R3081:Lama2 UTSW 10 26,877,231 (GRCm39) missense probably benign 0.11
R3107:Lama2 UTSW 10 26,877,231 (GRCm39) missense probably benign 0.11
R3109:Lama2 UTSW 10 26,877,231 (GRCm39) missense probably benign 0.11
R3436:Lama2 UTSW 10 26,877,231 (GRCm39) missense probably benign 0.11
R3437:Lama2 UTSW 10 26,877,231 (GRCm39) missense probably benign 0.11
R3706:Lama2 UTSW 10 27,014,992 (GRCm39) missense probably damaging 1.00
R3780:Lama2 UTSW 10 27,335,335 (GRCm39) missense probably damaging 1.00
R3807:Lama2 UTSW 10 27,066,661 (GRCm39) frame shift probably null
R3919:Lama2 UTSW 10 26,994,501 (GRCm39) missense probably damaging 1.00
R4014:Lama2 UTSW 10 26,860,372 (GRCm39) missense probably damaging 1.00
R4131:Lama2 UTSW 10 26,917,170 (GRCm39) missense probably benign 0.00
R4190:Lama2 UTSW 10 27,142,660 (GRCm39) missense probably damaging 0.96
R4273:Lama2 UTSW 10 27,223,050 (GRCm39) missense probably damaging 1.00
R4358:Lama2 UTSW 10 26,860,489 (GRCm39) missense probably damaging 1.00
R4407:Lama2 UTSW 10 27,088,124 (GRCm39) small deletion probably benign
R4415:Lama2 UTSW 10 26,865,340 (GRCm39) nonsense probably null
R4426:Lama2 UTSW 10 27,298,554 (GRCm39) missense probably damaging 1.00
R4590:Lama2 UTSW 10 26,865,410 (GRCm39) missense probably benign 0.00
R4615:Lama2 UTSW 10 26,857,520 (GRCm39) missense probably damaging 0.99
R4736:Lama2 UTSW 10 27,080,925 (GRCm39) missense probably damaging 1.00
R4754:Lama2 UTSW 10 26,994,527 (GRCm39) missense possibly damaging 0.58
R4791:Lama2 UTSW 10 27,343,267 (GRCm39) missense probably damaging 1.00
R4834:Lama2 UTSW 10 26,882,745 (GRCm39) missense probably benign 0.30
R4856:Lama2 UTSW 10 26,919,639 (GRCm39) frame shift probably null
R4858:Lama2 UTSW 10 26,919,639 (GRCm39) frame shift probably null
R4859:Lama2 UTSW 10 26,919,639 (GRCm39) frame shift probably null
R4897:Lama2 UTSW 10 26,919,639 (GRCm39) frame shift probably null
R4898:Lama2 UTSW 10 26,919,639 (GRCm39) frame shift probably null
R4899:Lama2 UTSW 10 26,919,639 (GRCm39) frame shift probably null
R4907:Lama2 UTSW 10 27,040,942 (GRCm39) missense probably benign 0.11
R4911:Lama2 UTSW 10 27,014,923 (GRCm39) missense probably damaging 1.00
R4924:Lama2 UTSW 10 27,245,137 (GRCm39) missense probably damaging 0.98
R5023:Lama2 UTSW 10 27,066,500 (GRCm39) missense probably damaging 0.97
R5057:Lama2 UTSW 10 27,040,982 (GRCm39) missense probably damaging 1.00
R5070:Lama2 UTSW 10 27,226,247 (GRCm39) critical splice donor site probably null
R5116:Lama2 UTSW 10 26,994,556 (GRCm39) missense probably benign 0.08
R5177:Lama2 UTSW 10 27,066,699 (GRCm39) missense possibly damaging 0.94
R5198:Lama2 UTSW 10 27,222,999 (GRCm39) missense probably damaging 0.96
R5289:Lama2 UTSW 10 27,088,069 (GRCm39) nonsense probably null
R5327:Lama2 UTSW 10 27,014,942 (GRCm39) missense probably benign
R5424:Lama2 UTSW 10 26,860,392 (GRCm39) missense probably damaging 1.00
R5469:Lama2 UTSW 10 26,917,185 (GRCm39) missense possibly damaging 0.92
R5620:Lama2 UTSW 10 26,866,876 (GRCm39) missense probably damaging 0.99
R5667:Lama2 UTSW 10 27,066,540 (GRCm39) missense probably damaging 1.00
R5671:Lama2 UTSW 10 27,066,540 (GRCm39) missense probably damaging 1.00
R5815:Lama2 UTSW 10 26,862,847 (GRCm39) missense probably damaging 1.00
R5917:Lama2 UTSW 10 27,066,693 (GRCm39) missense probably damaging 1.00
R5935:Lama2 UTSW 10 26,891,494 (GRCm39) missense probably benign
R5976:Lama2 UTSW 10 27,066,672 (GRCm39) missense probably benign 0.00
R5979:Lama2 UTSW 10 27,111,728 (GRCm39) missense probably damaging 0.99
R6004:Lama2 UTSW 10 27,111,781 (GRCm39) missense probably benign 0.01
R6180:Lama2 UTSW 10 26,857,495 (GRCm39) missense probably benign 0.03
R6198:Lama2 UTSW 10 27,064,018 (GRCm39) missense probably damaging 1.00
R6257:Lama2 UTSW 10 26,862,895 (GRCm39) missense possibly damaging 0.85
R6271:Lama2 UTSW 10 26,899,325 (GRCm39) missense possibly damaging 0.67
R6322:Lama2 UTSW 10 27,066,543 (GRCm39) missense probably damaging 0.96
R6354:Lama2 UTSW 10 27,088,064 (GRCm39) missense probably damaging 1.00
R6431:Lama2 UTSW 10 26,929,027 (GRCm39) missense possibly damaging 0.50
R6535:Lama2 UTSW 10 26,980,127 (GRCm39) missense probably damaging 1.00
R6545:Lama2 UTSW 10 27,052,793 (GRCm39) missense probably benign
R6636:Lama2 UTSW 10 27,000,564 (GRCm39) missense probably benign 0.13
R6891:Lama2 UTSW 10 27,204,078 (GRCm39) nonsense probably null
R6891:Lama2 UTSW 10 27,204,068 (GRCm39) nonsense probably null
R6902:Lama2 UTSW 10 26,857,625 (GRCm39) missense probably damaging 1.00
R6908:Lama2 UTSW 10 26,907,192 (GRCm39) splice site probably null
R7168:Lama2 UTSW 10 27,242,148 (GRCm39) critical splice acceptor site probably null
R7233:Lama2 UTSW 10 27,107,659 (GRCm39) missense probably damaging 1.00
R7272:Lama2 UTSW 10 27,000,552 (GRCm39) missense probably damaging 1.00
R7274:Lama2 UTSW 10 26,995,976 (GRCm39) missense probably damaging 0.99
R7419:Lama2 UTSW 10 27,142,630 (GRCm39) missense probably benign
R7423:Lama2 UTSW 10 27,088,222 (GRCm39) missense probably benign 0.00
R7554:Lama2 UTSW 10 27,031,492 (GRCm39) missense probably damaging 1.00
R7569:Lama2 UTSW 10 27,141,046 (GRCm39) missense probably damaging 1.00
R7574:Lama2 UTSW 10 26,882,726 (GRCm39) missense probably benign 0.03
R7584:Lama2 UTSW 10 26,980,257 (GRCm39) missense possibly damaging 0.78
R7586:Lama2 UTSW 10 26,977,389 (GRCm39) missense probably benign 0.00
R7603:Lama2 UTSW 10 27,142,676 (GRCm39) missense possibly damaging 0.55
R7691:Lama2 UTSW 10 27,084,389 (GRCm39) missense possibly damaging 0.67
R7750:Lama2 UTSW 10 26,866,920 (GRCm39) missense probably damaging 0.97
R7841:Lama2 UTSW 10 27,031,529 (GRCm39) missense probably benign 0.00
R7864:Lama2 UTSW 10 26,932,611 (GRCm39) missense probably benign 0.08
R7960:Lama2 UTSW 10 26,869,094 (GRCm39) missense probably benign 0.04
R7964:Lama2 UTSW 10 27,099,977 (GRCm39) critical splice donor site probably null
R7980:Lama2 UTSW 10 27,239,609 (GRCm39) missense probably damaging 0.98
R8013:Lama2 UTSW 10 27,220,494 (GRCm39) missense probably benign 0.00
R8028:Lama2 UTSW 10 27,204,145 (GRCm39) missense probably benign 0.13
R8097:Lama2 UTSW 10 27,066,660 (GRCm39) nonsense probably null
R8100:Lama2 UTSW 10 26,917,113 (GRCm39) missense probably benign 0.03
R8110:Lama2 UTSW 10 26,866,866 (GRCm39) missense probably damaging 1.00
R8122:Lama2 UTSW 10 26,930,592 (GRCm39) missense possibly damaging 0.87
R8264:Lama2 UTSW 10 27,343,218 (GRCm39) missense probably benign 0.07
R8315:Lama2 UTSW 10 27,298,655 (GRCm39) missense probably damaging 1.00
R8318:Lama2 UTSW 10 26,860,334 (GRCm39) missense probably damaging 1.00
R8419:Lama2 UTSW 10 27,298,559 (GRCm39) missense probably benign 0.26
R8475:Lama2 UTSW 10 26,977,369 (GRCm39) missense possibly damaging 0.69
R8735:Lama2 UTSW 10 27,066,530 (GRCm39) missense probably damaging 1.00
R8754:Lama2 UTSW 10 26,877,147 (GRCm39) missense possibly damaging 0.83
R8817:Lama2 UTSW 10 27,063,869 (GRCm39) missense probably damaging 1.00
R8851:Lama2 UTSW 10 27,242,119 (GRCm39) missense possibly damaging 0.94
R8859:Lama2 UTSW 10 27,335,384 (GRCm39) missense possibly damaging 0.58
R8886:Lama2 UTSW 10 27,245,157 (GRCm39) splice site probably benign
R8937:Lama2 UTSW 10 26,862,816 (GRCm39) missense probably damaging 1.00
R8993:Lama2 UTSW 10 27,298,710 (GRCm39) missense possibly damaging 0.91
R9025:Lama2 UTSW 10 26,860,367 (GRCm39) missense probably benign 0.00
R9027:Lama2 UTSW 10 27,080,881 (GRCm39) missense probably damaging 1.00
R9047:Lama2 UTSW 10 26,882,697 (GRCm39) missense possibly damaging 0.50
R9075:Lama2 UTSW 10 26,857,588 (GRCm39) missense probably damaging 1.00
R9135:Lama2 UTSW 10 27,298,515 (GRCm39) missense probably damaging 1.00
R9165:Lama2 UTSW 10 26,929,022 (GRCm39) critical splice donor site probably null
R9192:Lama2 UTSW 10 27,204,181 (GRCm39) missense possibly damaging 0.95
R9254:Lama2 UTSW 10 27,298,685 (GRCm39) missense probably damaging 0.96
R9326:Lama2 UTSW 10 26,906,193 (GRCm39) missense probably benign 0.04
R9356:Lama2 UTSW 10 27,088,186 (GRCm39) missense probably damaging 0.99
R9358:Lama2 UTSW 10 27,492,761 (GRCm39) missense unknown
R9358:Lama2 UTSW 10 27,064,378 (GRCm39) missense possibly damaging 0.95
R9376:Lama2 UTSW 10 26,994,620 (GRCm39) missense probably benign 0.11
R9381:Lama2 UTSW 10 27,064,023 (GRCm39) nonsense probably null
R9397:Lama2 UTSW 10 26,981,117 (GRCm39) missense probably benign 0.01
R9460:Lama2 UTSW 10 27,298,475 (GRCm39) missense probably damaging 1.00
R9478:Lama2 UTSW 10 26,891,478 (GRCm39) missense probably damaging 0.98
R9503:Lama2 UTSW 10 26,865,440 (GRCm39) missense possibly damaging 0.57
R9514:Lama2 UTSW 10 27,100,015 (GRCm39) missense probably benign 0.00
R9515:Lama2 UTSW 10 26,877,170 (GRCm39) missense probably benign 0.23
R9516:Lama2 UTSW 10 27,100,015 (GRCm39) missense probably benign 0.00
R9533:Lama2 UTSW 10 26,862,871 (GRCm39) missense probably damaging 1.00
R9619:Lama2 UTSW 10 27,064,282 (GRCm39) missense probably damaging 1.00
R9721:Lama2 UTSW 10 27,343,338 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTGGCTACCCCACAGCTATTATAAAC -3'
(R):5'- TAAAGCTGTGGCCAGTGGAG -3'

Sequencing Primer
(F):5'- TCAGGAGAGCACTTGATG -3'
(R):5'- CTGTGGCCAGTGGAGGTAAG -3'
Posted On 2018-06-06