Incidental Mutation 'R6499:Or1e1'
ID 519638
Institutional Source Beutler Lab
Gene Symbol Or1e1
Ensembl Gene ENSMUSG00000062128
Gene Name olfactory receptor family 1 subfamily E member 1
Synonyms MTPCR06, MOR135-11, Olfr20, Olfr21, MTPCR55, GA_x6K02T2P1NL-3514066-3515010
MMRRC Submission 044631-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.116) question?
Stock # R6499 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 73241685-73245525 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 73245011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 144 (L144Q)
Ref Sequence ENSEMBL: ENSMUSP00000114110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108465] [ENSMUST00000117445] [ENSMUST00000120137]
AlphaFold Q7TRX9
Predicted Effect probably damaging
Transcript: ENSMUST00000108465
AA Change: L144Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104105
Gene: ENSMUSG00000062128
AA Change: L144Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.9e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.8e-8 PFAM
Pfam:7tm_1 41 290 1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117445
Predicted Effect probably damaging
Transcript: ENSMUST00000120137
AA Change: L144Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114110
Gene: ENSMUSG00000062128
AA Change: L144Q

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.3e-61 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.5e-6 PFAM
Pfam:7tm_1 41 290 2.2e-26 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,774,561 (GRCm39) T1250M probably damaging Het
Actn1 C T 12: 80,215,191 (GRCm39) A857T possibly damaging Het
Adam2 C T 14: 66,296,239 (GRCm39) V207I probably damaging Het
Angpt2 T C 8: 18,744,533 (GRCm39) T404A probably benign Het
Ank3 T C 10: 69,827,574 (GRCm39) probably benign Het
Atosa C A 9: 74,930,930 (GRCm39) Q958K probably damaging Het
B4galt4 T A 16: 38,578,184 (GRCm39) D210E probably benign Het
Brinp3 A T 1: 146,777,431 (GRCm39) H626L possibly damaging Het
Ccna2 T G 3: 36,625,112 (GRCm39) D68A probably damaging Het
Cd163 G A 6: 124,281,703 (GRCm39) G2D probably benign Het
Chrm5 A T 2: 112,310,825 (GRCm39) V97D probably benign Het
Dctn5 G A 7: 121,734,320 (GRCm39) V55I probably benign Het
Dnm3 A T 1: 162,141,164 (GRCm39) I365N probably damaging Het
Esyt2 A G 12: 116,284,790 (GRCm39) D184G probably damaging Het
Ifi214 C A 1: 173,352,597 (GRCm39) K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 (GRCm39) P169L probably benign Het
Inhbb C T 1: 119,345,069 (GRCm39) E407K probably damaging Het
Lama2 T A 10: 26,907,154 (GRCm39) T2336S probably damaging Het
Ldhb A T 6: 142,439,847 (GRCm39) V231E possibly damaging Het
Lrit2 T C 14: 36,790,767 (GRCm39) F149L probably damaging Het
Malrd1 T A 2: 15,936,500 (GRCm39) S1575T probably benign Het
Naip5 A G 13: 100,358,102 (GRCm39) C1045R probably benign Het
Nefl A G 14: 68,322,034 (GRCm39) E208G probably damaging Het
Oog4 A C 4: 143,164,548 (GRCm39) S328A probably damaging Het
Or5p79 G T 7: 108,221,713 (GRCm39) M231I probably benign Het
Or6c216 T C 10: 129,678,453 (GRCm39) I153V probably benign Het
Or7e168 A G 9: 19,719,847 (GRCm39) I78V probably benign Het
Pbrm1 A G 14: 30,783,466 (GRCm39) N528D probably damaging Het
Pls1 A G 9: 95,636,798 (GRCm39) I558T probably damaging Het
Polq T C 16: 36,881,189 (GRCm39) S839P probably benign Het
Psmg1 A G 16: 95,789,297 (GRCm39) F87L probably damaging Het
Ptprt A G 2: 161,376,507 (GRCm39) M1298T probably benign Het
Rbm27 T A 18: 42,470,076 (GRCm39) W958R probably damaging Het
Skint5 T G 4: 113,396,552 (GRCm39) D1207A unknown Het
Stx17 T A 4: 48,183,478 (GRCm39) probably null Het
Tas2r114 A T 6: 131,666,099 (GRCm39) *310R probably null Het
Tmem130 T A 5: 144,689,224 (GRCm39) N139I probably damaging Het
Trpc1 T C 9: 95,608,490 (GRCm39) E267G probably damaging Het
Trrap T A 5: 144,793,812 (GRCm39) M3398K probably damaging Het
Vrtn T G 12: 84,697,090 (GRCm39) D613E probably benign Het
Vsx1 G T 2: 150,530,441 (GRCm39) T147K probably benign Het
Wdr55 T C 18: 36,895,231 (GRCm39) V103A probably benign Het
Zfp712 A T 13: 67,200,400 (GRCm39) D28E probably benign Het
Other mutations in Or1e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Or1e1 APN 11 73,244,869 (GRCm39) missense probably damaging 1.00
IGL02163:Or1e1 APN 11 73,245,320 (GRCm39) missense probably damaging 1.00
R0598:Or1e1 UTSW 11 73,244,729 (GRCm39) missense probably benign
R1348:Or1e1 UTSW 11 73,244,682 (GRCm39) missense probably benign 0.02
R2006:Or1e1 UTSW 11 73,245,518 (GRCm39) missense probably benign
R2085:Or1e1 UTSW 11 73,245,247 (GRCm39) missense possibly damaging 0.95
R2263:Or1e1 UTSW 11 73,245,131 (GRCm39) missense possibly damaging 0.89
R3421:Or1e1 UTSW 11 73,245,460 (GRCm39) missense probably damaging 1.00
R3422:Or1e1 UTSW 11 73,245,460 (GRCm39) missense probably damaging 1.00
R4229:Or1e1 UTSW 11 73,245,058 (GRCm39) missense probably damaging 1.00
R4749:Or1e1 UTSW 11 73,245,322 (GRCm39) missense probably damaging 1.00
R5410:Or1e1 UTSW 11 73,244,632 (GRCm39) missense probably benign 0.11
R6035:Or1e1 UTSW 11 73,244,582 (GRCm39) start codon destroyed probably null 1.00
R6035:Or1e1 UTSW 11 73,244,582 (GRCm39) start codon destroyed probably null 1.00
R7840:Or1e1 UTSW 11 73,244,585 (GRCm39) missense probably benign
R7959:Or1e1 UTSW 11 73,244,744 (GRCm39) missense probably damaging 1.00
R8186:Or1e1 UTSW 11 73,245,247 (GRCm39) missense possibly damaging 0.95
R9072:Or1e1 UTSW 11 73,244,797 (GRCm39) missense probably damaging 1.00
R9135:Or1e1 UTSW 11 73,245,316 (GRCm39) missense probably damaging 0.99
R9225:Or1e1 UTSW 11 73,244,595 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAATGCCCAAATTGCTGC -3'
(R):5'- AATGACAAGGATCAGGCCTC -3'

Sequencing Primer
(F):5'- TGCCCAAATTGCTGCAGAACATG -3'
(R):5'- AGGCCTCCTGTGACAAATATC -3'
Posted On 2018-06-06