Incidental Mutation 'R6499:Actn1'
ID519639
Institutional Source Beutler Lab
Gene Symbol Actn1
Ensembl Gene ENSMUSG00000015143
Gene Nameactinin, alpha 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R6499 (G1)
Quality Score216.009
Status Validated
Chromosome12
Chromosomal Location80167547-80260371 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80168417 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 857 (A857T)
Ref Sequence ENSEMBL: ENSMUSP00000127176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]
Predicted Effect probably benign
Transcript: ENSMUST00000021554
AA Change: A862T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143
AA Change: A862T

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 5.9e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 4.7e-14 PFAM
EFh 750 778 1.73e-5 SMART
EFh 791 819 8.13e-2 SMART
efhand_Ca_insen 822 888 5.22e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000167327
AA Change: A857T

PolyPhen 2 Score 0.592 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143
AA Change: A857T

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 1.7e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 8.4e-14 PFAM
EFh 750 778 1.36e0 SMART
EFh 786 814 8.13e-2 SMART
efhand_Ca_insen 817 883 5.22e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219634
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Actn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Actn1 APN 12 80199072 splice site probably null
IGL01152:Actn1 APN 12 80199046 missense probably damaging 1.00
IGL01386:Actn1 APN 12 80193672 missense probably benign 0.03
IGL01890:Actn1 APN 12 80184868 missense probably damaging 0.99
IGL01937:Actn1 APN 12 80171763 missense probably benign 0.03
IGL02142:Actn1 APN 12 80176155 critical splice donor site probably null
IGL02191:Actn1 APN 12 80174109 missense probably benign
IGL02217:Actn1 APN 12 80174094 nonsense probably null
IGL02230:Actn1 APN 12 80171830 missense probably benign 0.02
IGL03163:Actn1 APN 12 80181417 missense probably benign 0.33
IGL03401:Actn1 APN 12 80168967 nonsense probably null
R0538:Actn1 UTSW 12 80260100 unclassified probably benign
R0546:Actn1 UTSW 12 80178434 missense probably benign
R0583:Actn1 UTSW 12 80199029 missense probably damaging 1.00
R0606:Actn1 UTSW 12 80174647 splice site probably benign
R1340:Actn1 UTSW 12 80173144 critical splice acceptor site probably null
R1519:Actn1 UTSW 12 80205078 missense probably damaging 1.00
R1572:Actn1 UTSW 12 80172957 splice site probably benign
R1619:Actn1 UTSW 12 80173022 missense probably damaging 1.00
R1677:Actn1 UTSW 12 80260032 missense probably benign 0.02
R1994:Actn1 UTSW 12 80204971 nonsense probably null
R2102:Actn1 UTSW 12 80183517 missense probably benign 0.38
R2157:Actn1 UTSW 12 80173117 missense probably benign 0.04
R2191:Actn1 UTSW 12 80171802 nonsense probably null
R2519:Actn1 UTSW 12 80192389 missense probably damaging 1.00
R2988:Actn1 UTSW 12 80192388 missense possibly damaging 0.78
R4024:Actn1 UTSW 12 80168477 missense probably damaging 1.00
R4589:Actn1 UTSW 12 80171799 missense possibly damaging 0.53
R4907:Actn1 UTSW 12 80181414 missense probably damaging 0.99
R4936:Actn1 UTSW 12 80172998 missense probably benign 0.09
R4966:Actn1 UTSW 12 80173130 missense probably benign 0.01
R4972:Actn1 UTSW 12 80173039 missense probably benign 0.35
R5395:Actn1 UTSW 12 80170703 missense probably benign
R5460:Actn1 UTSW 12 80183568 missense probably benign 0.00
R5467:Actn1 UTSW 12 80176217 missense possibly damaging 0.86
R5470:Actn1 UTSW 12 80168941 missense probably damaging 0.99
R5661:Actn1 UTSW 12 80184844 missense probably benign 0.09
R5985:Actn1 UTSW 12 80168395 missense probably damaging 1.00
R6020:Actn1 UTSW 12 80174455 splice site probably null
R6042:Actn1 UTSW 12 80177249 missense probably benign 0.04
R6389:Actn1 UTSW 12 80174522 missense probably benign
R6709:Actn1 UTSW 12 80193644 missense probably damaging 1.00
R7016:Actn1 UTSW 12 80172968 missense possibly damaging 0.94
R7116:Actn1 UTSW 12 80204977 missense probably damaging 1.00
R7173:Actn1 UTSW 12 80177259 missense possibly damaging 0.70
R7183:Actn1 UTSW 12 80168932 missense possibly damaging 0.87
R7291:Actn1 UTSW 12 80174085 missense probably benign 0.00
R7361:Actn1 UTSW 12 80193715 missense probably benign 0.01
R7452:Actn1 UTSW 12 80183602 missense probably benign 0.12
R7698:Actn1 UTSW 12 80174537 missense probably benign 0.00
R7701:Actn1 UTSW 12 80174554 missense possibly damaging 0.88
R8000:Actn1 UTSW 12 80199008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTGAGCTGAAAATAATGAACC -3'
(R):5'- TGCACGCACGTATTCTACAG -3'

Sequencing Primer
(F):5'- TGAGCTGAAAATAATGAACCCAGCC -3'
(R):5'- CGCACGTATTCTACAGATCAAGTAG -3'
Posted On2018-06-06