Incidental Mutation 'R6499:Vrtn'
ID 519640
Institutional Source Beutler Lab
Gene Symbol Vrtn
Ensembl Gene ENSMUSG00000071235
Gene Name vertebrae development associated
Synonyms 7420416P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock # R6499 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 84641019-84651455 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 84650316 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 613 (D613E)
Ref Sequence ENSEMBL: ENSMUSP00000132050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095551] [ENSMUST00000166772] [ENSMUST00000167227] [ENSMUST00000221915] [ENSMUST00000222319]
AlphaFold Q3SYK4
Predicted Effect probably benign
Transcript: ENSMUST00000095551
AA Change: D613E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000093207
Gene: ENSMUSG00000071235
AA Change: D613E

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 254 267 N/A INTRINSIC
internal_repeat_1 312 354 6.24e-8 PROSPERO
low complexity region 393 405 N/A INTRINSIC
low complexity region 514 524 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
internal_repeat_1 687 731 6.24e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000166772
AA Change: D613E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000128808
Gene: ENSMUSG00000071235
AA Change: D613E

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 254 267 N/A INTRINSIC
internal_repeat_1 312 354 6.24e-8 PROSPERO
low complexity region 393 405 N/A INTRINSIC
low complexity region 514 524 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
internal_repeat_1 687 731 6.24e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000167227
AA Change: D613E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000132050
Gene: ENSMUSG00000071235
AA Change: D613E

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 254 267 N/A INTRINSIC
internal_repeat_1 312 354 6.24e-8 PROSPERO
low complexity region 393 405 N/A INTRINSIC
low complexity region 514 524 N/A INTRINSIC
low complexity region 569 580 N/A INTRINSIC
internal_repeat_1 687 731 6.24e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000221915
Predicted Effect probably benign
Transcript: ENSMUST00000222319
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Vrtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Vrtn APN 12 84649063 missense probably benign 0.01
IGL01777:Vrtn APN 12 84648922 missense probably benign 0.13
IGL01911:Vrtn APN 12 84650206 missense probably benign
IGL02219:Vrtn APN 12 84648833 missense probably damaging 1.00
IGL02684:Vrtn APN 12 84650149 missense probably benign
IGL02947:Vrtn APN 12 84648484 missense probably damaging 0.98
IGL03296:Vrtn APN 12 84648848 missense probably damaging 1.00
PIT4378001:Vrtn UTSW 12 84649169 missense probably damaging 0.99
R0044:Vrtn UTSW 12 84648605 missense probably damaging 1.00
R1546:Vrtn UTSW 12 84648508 missense probably damaging 1.00
R1584:Vrtn UTSW 12 84650081 missense probably damaging 1.00
R1693:Vrtn UTSW 12 84648655 missense probably benign 0.03
R1773:Vrtn UTSW 12 84650224 missense probably damaging 0.98
R1951:Vrtn UTSW 12 84649199 missense probably damaging 1.00
R2143:Vrtn UTSW 12 84650162 missense probably benign 0.00
R4044:Vrtn UTSW 12 84649070 missense probably damaging 1.00
R4777:Vrtn UTSW 12 84648826 missense probably damaging 1.00
R4835:Vrtn UTSW 12 84649694 missense probably damaging 0.97
R5076:Vrtn UTSW 12 84649474 missense probably damaging 1.00
R5783:Vrtn UTSW 12 84650477 missense probably benign 0.31
R5831:Vrtn UTSW 12 84648575 missense probably damaging 1.00
R6349:Vrtn UTSW 12 84649018 missense probably damaging 1.00
R6931:Vrtn UTSW 12 84650242 missense probably benign
R7192:Vrtn UTSW 12 84648862 missense probably damaging 0.98
R7789:Vrtn UTSW 12 84650306 missense probably benign
R8059:Vrtn UTSW 12 84649916 missense probably benign
R8095:Vrtn UTSW 12 84650035 missense probably damaging 1.00
R8096:Vrtn UTSW 12 84650035 missense probably damaging 1.00
R8136:Vrtn UTSW 12 84650035 missense probably damaging 1.00
R8142:Vrtn UTSW 12 84650621 missense probably damaging 1.00
R8557:Vrtn UTSW 12 84649916 missense probably benign
R9165:Vrtn UTSW 12 84650477 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AAAAGTCTTTCCCGGAGATCG -3'
(R):5'- TGGTAAGCATGTCCATCACCAG -3'

Sequencing Primer
(F):5'- ATCGCCCGGGATGCAGATTC -3'
(R):5'- TGTCCATCACCAGCACCTG -3'
Posted On 2018-06-06