Incidental Mutation 'R6499:Zfp712'
ID519642
Institutional Source Beutler Lab
Gene Symbol Zfp712
Ensembl Gene ENSMUSG00000090641
Gene Namezinc finger protein 712
Synonyms4921504N20Rik, mszf31, mszf89
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R6499 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location67038596-67061170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67052336 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 28 (D28E)
Ref Sequence ENSEMBL: ENSMUSP00000126665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167565]
Predicted Effect probably benign
Transcript: ENSMUST00000167565
AA Change: D28E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126665
Gene: ENSMUSG00000090641
AA Change: D28E

DomainStartEndE-ValueType
KRAB 5 65 7.38e-36 SMART
ZnF_C2H2 109 131 1.28e-3 SMART
ZnF_C2H2 137 159 4.17e-3 SMART
ZnF_C2H2 165 186 1.73e0 SMART
ZnF_C2H2 192 214 3.39e-3 SMART
ZnF_C2H2 220 242 1.58e-3 SMART
ZnF_C2H2 248 270 8.34e-3 SMART
ZnF_C2H2 276 298 4.17e-3 SMART
ZnF_C2H2 304 326 4.87e-4 SMART
ZnF_C2H2 332 354 1.04e-3 SMART
ZnF_C2H2 360 382 5.5e-3 SMART
ZnF_C2H2 388 410 1.89e-1 SMART
ZnF_C2H2 416 438 7.15e-2 SMART
ZnF_C2H2 444 466 3.58e-2 SMART
ZnF_C2H2 472 494 5.99e-4 SMART
ZnF_C2H2 500 522 2.12e-4 SMART
ZnF_C2H2 528 550 3.83e-2 SMART
ZnF_C2H2 556 578 2.95e-3 SMART
ZnF_C2H2 584 606 6.32e-3 SMART
ZnF_C2H2 612 634 3.89e-3 SMART
ZnF_C2H2 640 662 3.49e-5 SMART
ZnF_C2H2 668 690 1.84e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223867
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Other mutations in Zfp712
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Zfp712 APN 13 67042166 missense possibly damaging 0.55
IGL02148:Zfp712 APN 13 67042158 missense probably damaging 1.00
R0085:Zfp712 UTSW 13 67041192 missense probably benign 0.00
R0332:Zfp712 UTSW 13 67040813 missense probably damaging 1.00
R1676:Zfp712 UTSW 13 67052336 missense probably benign 0.00
R1838:Zfp712 UTSW 13 67042047 missense probably damaging 1.00
R1997:Zfp712 UTSW 13 67042050 nonsense probably null
R2147:Zfp712 UTSW 13 67041896 missense possibly damaging 0.94
R2203:Zfp712 UTSW 13 67041984 missense probably benign 0.32
R3421:Zfp712 UTSW 13 67052392 missense probably damaging 0.98
R3943:Zfp712 UTSW 13 67041332 missense probably benign 0.06
R4722:Zfp712 UTSW 13 67042113 missense probably benign 0.41
R4952:Zfp712 UTSW 13 67040841 missense possibly damaging 0.63
R4964:Zfp712 UTSW 13 67040612 missense probably damaging 1.00
R4966:Zfp712 UTSW 13 67040612 missense probably damaging 1.00
R4967:Zfp712 UTSW 13 67040709 nonsense probably null
R5114:Zfp712 UTSW 13 67041361 missense probably damaging 1.00
R5361:Zfp712 UTSW 13 67041015 missense possibly damaging 0.95
R5922:Zfp712 UTSW 13 67041604 missense probably benign 0.01
R5950:Zfp712 UTSW 13 67044817 missense probably damaging 0.99
R6004:Zfp712 UTSW 13 67041705 missense probably damaging 1.00
R6236:Zfp712 UTSW 13 67040621 missense probably damaging 1.00
R6298:Zfp712 UTSW 13 67041329 missense probably damaging 1.00
R6774:Zfp712 UTSW 13 67041504 missense probably benign 0.01
R6932:Zfp712 UTSW 13 67040827 nonsense probably null
R7410:Zfp712 UTSW 13 67041336 missense probably benign 0.00
R7914:Zfp712 UTSW 13 67052419 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTATGGAAGGCTTCTCCATTTG -3'
(R):5'- GTCTCGTCCCTTGAAGATGGATAG -3'

Sequencing Primer
(F):5'- GGAAGGCTTCTCCATTTGTAAGAATG -3'
(R):5'- GTGTAAAAGAATCTCATTCACTGCAC -3'
Posted On2018-06-06