Incidental Mutation 'R6499:Pbrm1'
ID 519644
Institutional Source Beutler Lab
Gene Symbol Pbrm1
Ensembl Gene ENSMUSG00000042323
Gene Name polybromo 1
Synonyms 2310032M22Rik, BAF180, 2610016F04Rik, Pb1
MMRRC Submission 044631-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6499 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 30741095-30843549 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 30783466 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 528 (N528D)
Ref Sequence ENSEMBL: ENSMUSP00000087682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022471] [ENSMUST00000022474] [ENSMUST00000052239] [ENSMUST00000090214] [ENSMUST00000112092] [ENSMUST00000112094] [ENSMUST00000112095] [ENSMUST00000112098] [ENSMUST00000123678] [ENSMUST00000146325] [ENSMUST00000135704] [ENSMUST00000136237] [ENSMUST00000156628]
AlphaFold Q8BSQ9
Predicted Effect probably benign
Transcript: ENSMUST00000022471
AA Change: N528D

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022471
Gene: ENSMUSG00000042323
AA Change: N528D

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1450 8.91e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022474
AA Change: N543D

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022474
Gene: ENSMUSG00000042323
AA Change: N543D

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1465 8.91e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052239
AA Change: N528D

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000060476
Gene: ENSMUSG00000042323
AA Change: N528D

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1049 8.64e-22 SMART
low complexity region 1058 1072 N/A INTRINSIC
BAH 1131 1247 3.02e-35 SMART
low complexity region 1293 1310 N/A INTRINSIC
HMG 1326 1396 2.87e-13 SMART
low complexity region 1405 1430 N/A INTRINSIC
low complexity region 1449 1477 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090214
AA Change: N528D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000087682
Gene: ENSMUSG00000042323
AA Change: N528D

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 1.62e-21 SMART
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 1485 1500 N/A INTRINSIC
low complexity region 1512 1537 N/A INTRINSIC
low complexity region 1556 1584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112092
AA Change: N543D

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107721
Gene: ENSMUSG00000042323
AA Change: N543D

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1519 1547 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112094
AA Change: N496D

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107723
Gene: ENSMUSG00000042323
AA Change: N496D

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 322 338 N/A INTRINSIC
BROMO 347 457 1.57e-32 SMART
BROMO 484 595 6.07e-39 SMART
BROMO 619 733 3.01e-43 SMART
BROMO 743 849 2.53e-18 SMART
coiled coil region 875 902 N/A INTRINSIC
BAH 924 1042 1.33e-45 SMART
low complexity region 1051 1065 N/A INTRINSIC
BAH 1124 1240 3.02e-35 SMART
low complexity region 1286 1306 N/A INTRINSIC
HMG 1346 1416 2.87e-13 SMART
low complexity region 1425 1450 N/A INTRINSIC
low complexity region 1469 1497 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112095
AA Change: N528D

PolyPhen 2 Score 0.744 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107724
Gene: ENSMUSG00000042323
AA Change: N528D

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 2.87e-13 SMART
low complexity region 1457 1482 N/A INTRINSIC
low complexity region 1501 1529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112098
AA Change: N543D

PolyPhen 2 Score 0.449 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107727
Gene: ENSMUSG00000042323
AA Change: N543D

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1500 1515 N/A INTRINSIC
low complexity region 1527 1552 N/A INTRINSIC
low complexity region 1571 1599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123678
AA Change: N528D

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120549
Gene: ENSMUSG00000042323
AA Change: N528D

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 856 2.3e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146325
AA Change: N517D

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122805
Gene: ENSMUSG00000042323
AA Change: N517D

DomainStartEndE-ValueType
BROMO 64 174 4.97e-35 SMART
BROMO 196 310 5.84e-41 SMART
low complexity region 343 359 N/A INTRINSIC
BROMO 368 478 1.57e-32 SMART
BROMO 505 616 6.07e-39 SMART
BROMO 640 754 3.01e-43 SMART
BROMO 764 870 2.53e-18 SMART
coiled coil region 896 923 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135704
AA Change: N487D

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000115505
Gene: ENSMUSG00000042323
AA Change: N487D

DomainStartEndE-ValueType
BROMO 1 97 3.24e-25 SMART
BROMO 119 233 5.84e-41 SMART
low complexity region 298 314 N/A INTRINSIC
BROMO 323 433 1.57e-32 SMART
BROMO 475 586 6.07e-39 SMART
BROMO 610 724 3.01e-43 SMART
BROMO 734 840 2.53e-18 SMART
low complexity region 862 892 N/A INTRINSIC
BAH 914 1032 1.33e-45 SMART
low complexity region 1041 1055 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136237
AA Change: N528D

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119722
Gene: ENSMUSG00000042323
AA Change: N528D

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 859 7.08e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156628
AA Change: N528D

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123546
Gene: ENSMUSG00000042323
AA Change: N528D

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
low complexity region 903 933 N/A INTRINSIC
BAH 955 1073 1.33e-45 SMART
low complexity region 1082 1096 N/A INTRINSIC
BAH 1155 1271 3.02e-35 SMART
low complexity region 1317 1337 N/A INTRINSIC
HMG 1377 1447 2.87e-13 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a subunit of ATP-dependent chromatin-remodeling complexes. The encoded protein has been identified as in integral component of complexes necessary for ligand-dependent transcriptional activation by nuclear hormone receptors. Mutations at this locus have been associated with primary clear cell renal cell carcinoma. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality with hypoplastic cardiac ventricular chambers and malformation of the placenta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,774,561 (GRCm39) T1250M probably damaging Het
Actn1 C T 12: 80,215,191 (GRCm39) A857T possibly damaging Het
Adam2 C T 14: 66,296,239 (GRCm39) V207I probably damaging Het
Angpt2 T C 8: 18,744,533 (GRCm39) T404A probably benign Het
Ank3 T C 10: 69,827,574 (GRCm39) probably benign Het
Atosa C A 9: 74,930,930 (GRCm39) Q958K probably damaging Het
B4galt4 T A 16: 38,578,184 (GRCm39) D210E probably benign Het
Brinp3 A T 1: 146,777,431 (GRCm39) H626L possibly damaging Het
Ccna2 T G 3: 36,625,112 (GRCm39) D68A probably damaging Het
Cd163 G A 6: 124,281,703 (GRCm39) G2D probably benign Het
Chrm5 A T 2: 112,310,825 (GRCm39) V97D probably benign Het
Dctn5 G A 7: 121,734,320 (GRCm39) V55I probably benign Het
Dnm3 A T 1: 162,141,164 (GRCm39) I365N probably damaging Het
Esyt2 A G 12: 116,284,790 (GRCm39) D184G probably damaging Het
Ifi214 C A 1: 173,352,597 (GRCm39) K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 (GRCm39) P169L probably benign Het
Inhbb C T 1: 119,345,069 (GRCm39) E407K probably damaging Het
Lama2 T A 10: 26,907,154 (GRCm39) T2336S probably damaging Het
Ldhb A T 6: 142,439,847 (GRCm39) V231E possibly damaging Het
Lrit2 T C 14: 36,790,767 (GRCm39) F149L probably damaging Het
Malrd1 T A 2: 15,936,500 (GRCm39) S1575T probably benign Het
Naip5 A G 13: 100,358,102 (GRCm39) C1045R probably benign Het
Nefl A G 14: 68,322,034 (GRCm39) E208G probably damaging Het
Oog4 A C 4: 143,164,548 (GRCm39) S328A probably damaging Het
Or1e1 T A 11: 73,245,011 (GRCm39) L144Q probably damaging Het
Or5p79 G T 7: 108,221,713 (GRCm39) M231I probably benign Het
Or6c216 T C 10: 129,678,453 (GRCm39) I153V probably benign Het
Or7e168 A G 9: 19,719,847 (GRCm39) I78V probably benign Het
Pls1 A G 9: 95,636,798 (GRCm39) I558T probably damaging Het
Polq T C 16: 36,881,189 (GRCm39) S839P probably benign Het
Psmg1 A G 16: 95,789,297 (GRCm39) F87L probably damaging Het
Ptprt A G 2: 161,376,507 (GRCm39) M1298T probably benign Het
Rbm27 T A 18: 42,470,076 (GRCm39) W958R probably damaging Het
Skint5 T G 4: 113,396,552 (GRCm39) D1207A unknown Het
Stx17 T A 4: 48,183,478 (GRCm39) probably null Het
Tas2r114 A T 6: 131,666,099 (GRCm39) *310R probably null Het
Tmem130 T A 5: 144,689,224 (GRCm39) N139I probably damaging Het
Trpc1 T C 9: 95,608,490 (GRCm39) E267G probably damaging Het
Trrap T A 5: 144,793,812 (GRCm39) M3398K probably damaging Het
Vrtn T G 12: 84,697,090 (GRCm39) D613E probably benign Het
Vsx1 G T 2: 150,530,441 (GRCm39) T147K probably benign Het
Wdr55 T C 18: 36,895,231 (GRCm39) V103A probably benign Het
Zfp712 A T 13: 67,200,400 (GRCm39) D28E probably benign Het
Other mutations in Pbrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Pbrm1 APN 14 30,752,884 (GRCm39) missense probably damaging 1.00
IGL00648:Pbrm1 APN 14 30,774,240 (GRCm39) missense probably damaging 1.00
IGL00654:Pbrm1 APN 14 30,754,361 (GRCm39) splice site probably benign
IGL00674:Pbrm1 APN 14 30,840,733 (GRCm39) missense probably damaging 1.00
IGL00701:Pbrm1 APN 14 30,774,205 (GRCm39) missense probably damaging 1.00
IGL00850:Pbrm1 APN 14 30,809,576 (GRCm39) missense probably damaging 1.00
IGL01024:Pbrm1 APN 14 30,774,217 (GRCm39) missense probably damaging 1.00
IGL01924:Pbrm1 APN 14 30,804,561 (GRCm39) missense probably damaging 1.00
IGL02122:Pbrm1 APN 14 30,811,573 (GRCm39) missense probably damaging 0.97
IGL02390:Pbrm1 APN 14 30,754,467 (GRCm39) missense probably benign 0.00
IGL02675:Pbrm1 APN 14 30,828,244 (GRCm39) missense possibly damaging 0.85
IGL02936:Pbrm1 APN 14 30,783,470 (GRCm39) missense probably damaging 1.00
IGL02938:Pbrm1 APN 14 30,789,761 (GRCm39) missense probably damaging 1.00
IGL02997:Pbrm1 APN 14 30,783,508 (GRCm39) missense probably damaging 1.00
IGL03246:Pbrm1 APN 14 30,832,506 (GRCm39) missense probably benign 0.00
IGL03290:Pbrm1 APN 14 30,829,241 (GRCm39) missense probably damaging 1.00
IGL03372:Pbrm1 APN 14 30,806,976 (GRCm39) missense probably benign 0.04
IGL03386:Pbrm1 APN 14 30,772,049 (GRCm39) missense probably damaging 1.00
PIT4520001:Pbrm1 UTSW 14 30,789,818 (GRCm39) missense probably damaging 0.99
R0502:Pbrm1 UTSW 14 30,786,777 (GRCm39) missense probably benign 0.36
R0552:Pbrm1 UTSW 14 30,757,916 (GRCm39) missense probably damaging 1.00
R0558:Pbrm1 UTSW 14 30,807,016 (GRCm39) splice site probably null
R0561:Pbrm1 UTSW 14 30,757,948 (GRCm39) missense probably benign
R0591:Pbrm1 UTSW 14 30,768,387 (GRCm39) splice site probably benign
R0835:Pbrm1 UTSW 14 30,789,536 (GRCm39) missense probably damaging 1.00
R1167:Pbrm1 UTSW 14 30,772,099 (GRCm39) missense probably damaging 1.00
R1209:Pbrm1 UTSW 14 30,840,809 (GRCm39) missense probably damaging 1.00
R1259:Pbrm1 UTSW 14 30,796,771 (GRCm39) missense probably damaging 1.00
R1321:Pbrm1 UTSW 14 30,789,459 (GRCm39) missense probably damaging 1.00
R1622:Pbrm1 UTSW 14 30,754,505 (GRCm39) missense probably benign 0.07
R1843:Pbrm1 UTSW 14 30,760,914 (GRCm39) missense probably damaging 1.00
R1870:Pbrm1 UTSW 14 30,828,132 (GRCm39) missense probably damaging 0.99
R2202:Pbrm1 UTSW 14 30,754,406 (GRCm39) missense possibly damaging 0.76
R2203:Pbrm1 UTSW 14 30,754,406 (GRCm39) missense possibly damaging 0.76
R2247:Pbrm1 UTSW 14 30,796,850 (GRCm39) missense probably damaging 1.00
R3237:Pbrm1 UTSW 14 30,754,432 (GRCm39) missense probably damaging 1.00
R4091:Pbrm1 UTSW 14 30,757,960 (GRCm39) missense probably benign 0.00
R4280:Pbrm1 UTSW 14 30,829,269 (GRCm39) critical splice donor site probably null
R4379:Pbrm1 UTSW 14 30,789,663 (GRCm39) missense probably damaging 1.00
R4381:Pbrm1 UTSW 14 30,747,513 (GRCm39) missense probably benign 0.02
R4816:Pbrm1 UTSW 14 30,832,405 (GRCm39) missense probably benign 0.32
R4939:Pbrm1 UTSW 14 30,783,580 (GRCm39) missense probably damaging 1.00
R4945:Pbrm1 UTSW 14 30,774,173 (GRCm39) missense probably damaging 0.97
R4958:Pbrm1 UTSW 14 30,796,784 (GRCm39) missense probably damaging 1.00
R5095:Pbrm1 UTSW 14 30,754,487 (GRCm39) missense probably benign 0.00
R5276:Pbrm1 UTSW 14 30,828,141 (GRCm39) missense probably damaging 0.99
R5387:Pbrm1 UTSW 14 30,804,567 (GRCm39) missense probably damaging 1.00
R5434:Pbrm1 UTSW 14 30,806,968 (GRCm39) missense probably damaging 0.96
R5476:Pbrm1 UTSW 14 30,754,476 (GRCm39) missense probably benign 0.00
R5522:Pbrm1 UTSW 14 30,811,520 (GRCm39) missense probably damaging 1.00
R5548:Pbrm1 UTSW 14 30,827,381 (GRCm39) missense probably damaging 1.00
R5605:Pbrm1 UTSW 14 30,757,949 (GRCm39) missense probably benign 0.20
R6089:Pbrm1 UTSW 14 30,809,542 (GRCm39) missense probably damaging 0.99
R6159:Pbrm1 UTSW 14 30,774,240 (GRCm39) missense possibly damaging 0.95
R6224:Pbrm1 UTSW 14 30,772,068 (GRCm39) missense probably benign 0.19
R6335:Pbrm1 UTSW 14 30,806,052 (GRCm39) missense probably damaging 1.00
R6823:Pbrm1 UTSW 14 30,806,747 (GRCm39) missense probably damaging 1.00
R7002:Pbrm1 UTSW 14 30,786,777 (GRCm39) missense probably benign 0.36
R7021:Pbrm1 UTSW 14 30,789,773 (GRCm39) missense probably damaging 0.98
R7216:Pbrm1 UTSW 14 30,767,379 (GRCm39) missense possibly damaging 0.93
R7588:Pbrm1 UTSW 14 30,806,900 (GRCm39) missense probably damaging 0.99
R7828:Pbrm1 UTSW 14 30,752,848 (GRCm39) missense probably damaging 1.00
R8035:Pbrm1 UTSW 14 30,806,109 (GRCm39) missense probably damaging 1.00
R8188:Pbrm1 UTSW 14 30,789,773 (GRCm39) missense probably damaging 0.98
R8417:Pbrm1 UTSW 14 30,749,419 (GRCm39) missense possibly damaging 0.92
R8517:Pbrm1 UTSW 14 30,789,739 (GRCm39) missense probably benign 0.00
R9024:Pbrm1 UTSW 14 30,783,623 (GRCm39) missense probably damaging 1.00
R9294:Pbrm1 UTSW 14 30,806,760 (GRCm39) nonsense probably null
R9509:Pbrm1 UTSW 14 30,806,914 (GRCm39) missense probably damaging 1.00
R9713:Pbrm1 UTSW 14 30,828,123 (GRCm39) missense probably damaging 0.99
Z1088:Pbrm1 UTSW 14 30,832,411 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CAGCGTGCTTACAATGTTTATGAC -3'
(R):5'- GCATTGCGGAACATGAGTTTC -3'

Sequencing Primer
(F):5'- CGTGCTTACAATGTTTATGACACATC -3'
(R):5'- ATGAGTTTCATGTCTTCCATCATTC -3'
Posted On 2018-06-06