Incidental Mutation 'R6499:Lrit2'
ID519645
Institutional Source Beutler Lab
Gene Symbol Lrit2
Ensembl Gene ENSMUSG00000043418
Gene Nameleucine-rich repeat, immunoglobulin-like and transmembrane domains 2
SynonymsA930010E21Rik, Lrrc22
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6499 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location37067929-37073743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37068810 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 149 (F149L)
Ref Sequence ENSEMBL: ENSMUSP00000056642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057176] [ENSMUST00000120052]
Predicted Effect probably damaging
Transcript: ENSMUST00000057176
AA Change: F149L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056642
Gene: ENSMUSG00000043418
AA Change: F149L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 23 59 7.74e-2 SMART
LRR 78 101 9.96e-1 SMART
LRR_TYP 102 125 8.94e-3 SMART
LRR 126 149 2.03e1 SMART
LRR_TYP 150 173 7.67e-2 SMART
LRRCT 200 251 7.12e-7 SMART
IGc2 265 334 2.05e-9 SMART
FN3 362 443 5.94e0 SMART
transmembrane domain 463 485 N/A INTRINSIC
low complexity region 538 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120052
SMART Domains Protein: ENSMUSP00000113964
Gene: ENSMUSG00000041044

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 22 63 1.97e-3 SMART
LRR 82 105 1.03e1 SMART
LRR 106 129 3e1 SMART
LRR 130 152 1.12e1 SMART
LRR_TYP 154 177 4.47e-3 SMART
LRRCT 201 253 2.04e-7 SMART
IGc2 267 336 6.55e-8 SMART
FN3 429 506 2.22e0 SMART
transmembrane domain 531 553 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
low complexity region 597 608 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224104
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Lrit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Lrit2 APN 14 37071963 missense probably benign 0.31
IGL01475:Lrit2 APN 14 37069094 missense probably damaging 1.00
IGL02080:Lrit2 APN 14 37069074 missense probably damaging 0.99
IGL02141:Lrit2 APN 14 37068074 unclassified probably benign
IGL02479:Lrit2 APN 14 37072278 missense probably damaging 0.99
IGL02715:Lrit2 APN 14 37072548 missense probably benign 0.00
R0114:Lrit2 UTSW 14 37068045 splice site probably null
R1344:Lrit2 UTSW 14 37068556 missense probably benign 0.32
R1529:Lrit2 UTSW 14 37068827 missense probably benign 0.12
R1641:Lrit2 UTSW 14 37069148 missense probably benign 0.34
R2105:Lrit2 UTSW 14 37071956 missense probably damaging 1.00
R4365:Lrit2 UTSW 14 37072119 missense probably damaging 1.00
R4645:Lrit2 UTSW 14 37072475 missense probably benign
R5226:Lrit2 UTSW 14 37072353 missense probably damaging 1.00
R5377:Lrit2 UTSW 14 37069183 missense possibly damaging 0.59
R5387:Lrit2 UTSW 14 37072259 missense probably damaging 1.00
R5840:Lrit2 UTSW 14 37069005 missense possibly damaging 0.64
R5881:Lrit2 UTSW 14 37072235 missense probably benign 0.02
R6863:Lrit2 UTSW 14 37071944 missense probably damaging 0.99
R7307:Lrit2 UTSW 14 37072199 missense probably benign 0.00
R7316:Lrit2 UTSW 14 37068858 missense probably damaging 1.00
R7491:Lrit2 UTSW 14 37068910 missense possibly damaging 0.83
R7525:Lrit2 UTSW 14 37072493 missense possibly damaging 0.76
R7640:Lrit2 UTSW 14 37072124 missense probably damaging 1.00
R8228:Lrit2 UTSW 14 37069191 missense probably damaging 1.00
R8397:Lrit2 UTSW 14 37069077 missense probably damaging 0.98
R8815:Lrit2 UTSW 14 37072530 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACCAACATGAGCAGTTTGG -3'
(R):5'- TAATCGGCAGTCGCACAACC -3'

Sequencing Primer
(F):5'- CAGTTTGGAATACCTTTGGCTCAAC -3'
(R):5'- CAGTCGCACAACCAAGGATTATTGTG -3'
Posted On2018-06-06