Incidental Mutation 'R6499:Adam2'
ID 519646
Institutional Source Beutler Lab
Gene Symbol Adam2
Ensembl Gene ENSMUSG00000022039
Gene Name a disintegrin and metallopeptidase domain 2
Synonyms fertilin beta, Ph30-beta, Ftnb
MMRRC Submission 044631-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6499 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 66264778-66315182 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 66296239 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 207 (V207I)
Ref Sequence ENSEMBL: ENSMUSP00000022618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022618]
AlphaFold Q60718
Predicted Effect probably damaging
Transcript: ENSMUST00000022618
AA Change: V207I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022618
Gene: ENSMUSG00000022039
AA Change: V207I

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 17 147 2.1e-26 PFAM
Pfam:Reprolysin 184 381 7.1e-73 PFAM
DISIN 398 474 1.21e-27 SMART
ACR 475 612 6.96e-62 SMART
transmembrane domain 687 709 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225667
Meta Mutation Damage Score 0.6345 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is predominantly expressed in the epididymis, where the encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Male mice lacking the encoded protein are infertile and exhibit multiple defects in reproduction. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are viable, females are fertile, but males have severely reduced fertility. Mutant male sperm are defective in sperm-egg membrane adhesion, sperm-egg fusion, migration from the uterus to theoviduct, and binding to the egg zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,774,561 (GRCm39) T1250M probably damaging Het
Actn1 C T 12: 80,215,191 (GRCm39) A857T possibly damaging Het
Angpt2 T C 8: 18,744,533 (GRCm39) T404A probably benign Het
Ank3 T C 10: 69,827,574 (GRCm39) probably benign Het
Atosa C A 9: 74,930,930 (GRCm39) Q958K probably damaging Het
B4galt4 T A 16: 38,578,184 (GRCm39) D210E probably benign Het
Brinp3 A T 1: 146,777,431 (GRCm39) H626L possibly damaging Het
Ccna2 T G 3: 36,625,112 (GRCm39) D68A probably damaging Het
Cd163 G A 6: 124,281,703 (GRCm39) G2D probably benign Het
Chrm5 A T 2: 112,310,825 (GRCm39) V97D probably benign Het
Dctn5 G A 7: 121,734,320 (GRCm39) V55I probably benign Het
Dnm3 A T 1: 162,141,164 (GRCm39) I365N probably damaging Het
Esyt2 A G 12: 116,284,790 (GRCm39) D184G probably damaging Het
Ifi214 C A 1: 173,352,597 (GRCm39) K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 (GRCm39) P169L probably benign Het
Inhbb C T 1: 119,345,069 (GRCm39) E407K probably damaging Het
Lama2 T A 10: 26,907,154 (GRCm39) T2336S probably damaging Het
Ldhb A T 6: 142,439,847 (GRCm39) V231E possibly damaging Het
Lrit2 T C 14: 36,790,767 (GRCm39) F149L probably damaging Het
Malrd1 T A 2: 15,936,500 (GRCm39) S1575T probably benign Het
Naip5 A G 13: 100,358,102 (GRCm39) C1045R probably benign Het
Nefl A G 14: 68,322,034 (GRCm39) E208G probably damaging Het
Oog4 A C 4: 143,164,548 (GRCm39) S328A probably damaging Het
Or1e1 T A 11: 73,245,011 (GRCm39) L144Q probably damaging Het
Or5p79 G T 7: 108,221,713 (GRCm39) M231I probably benign Het
Or6c216 T C 10: 129,678,453 (GRCm39) I153V probably benign Het
Or7e168 A G 9: 19,719,847 (GRCm39) I78V probably benign Het
Pbrm1 A G 14: 30,783,466 (GRCm39) N528D probably damaging Het
Pls1 A G 9: 95,636,798 (GRCm39) I558T probably damaging Het
Polq T C 16: 36,881,189 (GRCm39) S839P probably benign Het
Psmg1 A G 16: 95,789,297 (GRCm39) F87L probably damaging Het
Ptprt A G 2: 161,376,507 (GRCm39) M1298T probably benign Het
Rbm27 T A 18: 42,470,076 (GRCm39) W958R probably damaging Het
Skint5 T G 4: 113,396,552 (GRCm39) D1207A unknown Het
Stx17 T A 4: 48,183,478 (GRCm39) probably null Het
Tas2r114 A T 6: 131,666,099 (GRCm39) *310R probably null Het
Tmem130 T A 5: 144,689,224 (GRCm39) N139I probably damaging Het
Trpc1 T C 9: 95,608,490 (GRCm39) E267G probably damaging Het
Trrap T A 5: 144,793,812 (GRCm39) M3398K probably damaging Het
Vrtn T G 12: 84,697,090 (GRCm39) D613E probably benign Het
Vsx1 G T 2: 150,530,441 (GRCm39) T147K probably benign Het
Wdr55 T C 18: 36,895,231 (GRCm39) V103A probably benign Het
Zfp712 A T 13: 67,200,400 (GRCm39) D28E probably benign Het
Other mutations in Adam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Adam2 APN 14 66,311,498 (GRCm39) critical splice donor site probably null
IGL00980:Adam2 APN 14 66,293,977 (GRCm39) nonsense probably null
IGL01404:Adam2 APN 14 66,314,659 (GRCm39) critical splice donor site probably null
IGL01901:Adam2 APN 14 66,272,678 (GRCm39) splice site probably benign
IGL02687:Adam2 APN 14 66,306,639 (GRCm39) missense probably damaging 1.00
IGL02692:Adam2 APN 14 66,311,536 (GRCm39) missense probably damaging 1.00
IGL02695:Adam2 APN 14 66,287,929 (GRCm39) missense probably benign 0.01
IGL02798:Adam2 APN 14 66,277,724 (GRCm39) missense probably damaging 1.00
IGL03217:Adam2 APN 14 66,272,262 (GRCm39) missense possibly damaging 0.85
IGL03256:Adam2 APN 14 66,291,280 (GRCm39) missense probably benign 0.03
aldrin UTSW 14 66,295,086 (GRCm39) missense probably damaging 1.00
armstrong UTSW 14 66,275,006 (GRCm39) missense possibly damaging 0.95
sacher UTSW 14 66,306,007 (GRCm39) missense probably damaging 1.00
zuker UTSW 14 66,297,361 (GRCm39) missense probably benign 0.14
R0092:Adam2 UTSW 14 66,291,336 (GRCm39) missense probably damaging 1.00
R0281:Adam2 UTSW 14 66,275,055 (GRCm39) missense probably benign 0.20
R0636:Adam2 UTSW 14 66,272,265 (GRCm39) missense probably benign 0.03
R0690:Adam2 UTSW 14 66,295,095 (GRCm39) missense probably damaging 1.00
R0727:Adam2 UTSW 14 66,267,180 (GRCm39) missense probably damaging 1.00
R1477:Adam2 UTSW 14 66,315,149 (GRCm39) missense possibly damaging 0.96
R1634:Adam2 UTSW 14 66,295,180 (GRCm39) missense probably damaging 1.00
R1652:Adam2 UTSW 14 66,314,700 (GRCm39) missense probably benign 0.41
R1717:Adam2 UTSW 14 66,306,007 (GRCm39) missense probably damaging 1.00
R1868:Adam2 UTSW 14 66,315,107 (GRCm39) missense probably damaging 0.99
R1915:Adam2 UTSW 14 66,275,006 (GRCm39) missense possibly damaging 0.95
R3748:Adam2 UTSW 14 66,297,361 (GRCm39) missense probably benign 0.14
R3953:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R3954:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R3955:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R3956:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R3957:Adam2 UTSW 14 66,295,059 (GRCm39) missense probably damaging 1.00
R4091:Adam2 UTSW 14 66,267,172 (GRCm39) missense probably damaging 0.97
R5673:Adam2 UTSW 14 66,306,681 (GRCm39) missense probably benign 0.03
R5761:Adam2 UTSW 14 66,283,595 (GRCm39) missense probably damaging 1.00
R6187:Adam2 UTSW 14 66,306,068 (GRCm39) missense possibly damaging 0.89
R6730:Adam2 UTSW 14 66,275,025 (GRCm39) missense possibly damaging 0.83
R6829:Adam2 UTSW 14 66,265,446 (GRCm39) critical splice donor site probably null
R7023:Adam2 UTSW 14 66,280,505 (GRCm39) missense probably benign 0.22
R7168:Adam2 UTSW 14 66,296,241 (GRCm39) missense possibly damaging 0.89
R7228:Adam2 UTSW 14 66,291,361 (GRCm39) nonsense probably null
R7293:Adam2 UTSW 14 66,272,634 (GRCm39) missense probably benign 0.29
R7604:Adam2 UTSW 14 66,293,990 (GRCm39) missense probably benign 0.17
R7765:Adam2 UTSW 14 66,297,345 (GRCm39) missense probably damaging 1.00
R8380:Adam2 UTSW 14 66,275,006 (GRCm39) missense probably benign 0.01
R8532:Adam2 UTSW 14 66,293,970 (GRCm39) missense probably damaging 1.00
R8728:Adam2 UTSW 14 66,295,086 (GRCm39) missense probably damaging 1.00
R8744:Adam2 UTSW 14 66,272,165 (GRCm39) critical splice donor site probably null
R9282:Adam2 UTSW 14 66,267,238 (GRCm39) missense probably benign 0.00
R9307:Adam2 UTSW 14 66,287,921 (GRCm39) missense probably damaging 1.00
R9560:Adam2 UTSW 14 66,275,102 (GRCm39) missense probably benign 0.12
R9574:Adam2 UTSW 14 66,275,071 (GRCm39) missense probably benign 0.10
R9608:Adam2 UTSW 14 66,291,279 (GRCm39) missense probably null 0.05
X0061:Adam2 UTSW 14 66,291,354 (GRCm39) missense possibly damaging 0.66
Z1177:Adam2 UTSW 14 66,293,970 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGTGCCACAAAAGAAGATC -3'
(R):5'- GTGGAATTACATCTTGTACTTTTCTCG -3'

Sequencing Primer
(F):5'- TTAAGGACCTGAACTCTCTGGGAC -3'
(R):5'- TTCTCGGATCTTTTTATATTTCCCAC -3'
Posted On 2018-06-06