Incidental Mutation 'R6499:Polq'
ID 519648
Institutional Source Beutler Lab
Gene Symbol Polq
Ensembl Gene ENSMUSG00000034206
Gene Name polymerase (DNA directed), theta
Synonyms A430110D14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock # R6499 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 37011786-37095417 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37060827 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 839 (S839P)
Ref Sequence ENSEMBL: ENSMUSP00000071396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]
AlphaFold Q8CGS6
Predicted Effect probably benign
Transcript: ENSMUST00000054034
AA Change: S1118P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206
AA Change: S1118P

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
DEXDc 87 298 4.09e-18 SMART
HELICc 398 484 4.02e-17 SMART
Blast:DEXDc 485 550 2e-25 BLAST
low complexity region 609 626 N/A INTRINSIC
PDB:2ZJA|A 712 826 5e-9 PDB
low complexity region 845 852 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
low complexity region 1126 1149 N/A INTRINSIC
low complexity region 1813 1822 N/A INTRINSIC
POLAc 2265 2504 3.3e-101 SMART
low complexity region 2521 2531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071452
AA Change: S839P

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206
AA Change: S839P

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 216 5.9e-12 PFAM
low complexity region 330 347 N/A INTRINSIC
PDB:2ZJA|A 433 547 5e-9 PDB
low complexity region 566 573 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 847 870 N/A INTRINSIC
low complexity region 1534 1543 N/A INTRINSIC
POLAc 1986 2225 3.3e-101 SMART
low complexity region 2242 2252 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182622
Predicted Effect probably benign
Transcript: ENSMUST00000182946
SMART Domains Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183112
SMART Domains Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Polq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Polq APN 16 37065247 splice site probably benign
IGL00539:Polq APN 16 37060569 missense probably damaging 0.98
IGL00960:Polq APN 16 37060512 missense probably damaging 0.96
IGL01100:Polq APN 16 37061112 missense probably benign
IGL01112:Polq APN 16 37017309 missense probably damaging 1.00
IGL01138:Polq APN 16 37045869 missense possibly damaging 0.94
IGL01432:Polq APN 16 37071822 splice site probably benign
IGL01522:Polq APN 16 37027903 missense probably damaging 1.00
IGL01565:Polq APN 16 37013113 missense probably benign 0.00
IGL01592:Polq APN 16 37034850 missense probably benign 0.01
IGL01690:Polq APN 16 37062838 missense probably damaging 0.97
IGL01943:Polq APN 16 37061443 missense possibly damaging 0.47
IGL02531:Polq APN 16 37062374 missense possibly damaging 0.75
IGL02553:Polq APN 16 37041768 missense probably damaging 1.00
IGL02623:Polq APN 16 37060375 missense probably benign 0.04
IGL02692:Polq APN 16 37060627 missense probably damaging 1.00
IGL02717:Polq APN 16 37022740 missense probably damaging 1.00
IGL02937:Polq APN 16 37013109 missense probably benign 0.14
IGL02959:Polq APN 16 37086566 missense probably damaging 1.00
IGL03086:Polq APN 16 37091049 missense probably benign 0.02
IGL03141:Polq APN 16 37017358 splice site probably benign
IGL03302:Polq APN 16 37071772 missense probably damaging 1.00
IGL03393:Polq APN 16 37044794 missense probably damaging 1.00
R0013_Polq_667 UTSW 16 37061839 missense possibly damaging 0.56
R4238_Polq_233 UTSW 16 37013181 missense probably damaging 1.00
R4280_polq_867 UTSW 16 37082057 missense probably damaging 1.00
G1Funyon:Polq UTSW 16 37061819 missense probably damaging 1.00
PIT4403001:Polq UTSW 16 37060587 missense probably benign 0.00
R0013:Polq UTSW 16 37061839 missense possibly damaging 0.56
R0082:Polq UTSW 16 37017257 missense probably benign 0.01
R0212:Polq UTSW 16 37066854 missense probably damaging 0.99
R0387:Polq UTSW 16 37029430 missense probably damaging 1.00
R0387:Polq UTSW 16 37089317 missense probably damaging 1.00
R0427:Polq UTSW 16 37061993 nonsense probably null
R0454:Polq UTSW 16 37034890 missense probably damaging 0.98
R0513:Polq UTSW 16 37094502 missense probably damaging 1.00
R0622:Polq UTSW 16 37060993 missense probably benign 0.02
R0848:Polq UTSW 16 37062130 missense probably benign 0.08
R1142:Polq UTSW 16 37013217 missense probably damaging 0.98
R1218:Polq UTSW 16 37029446 missense possibly damaging 0.93
R1331:Polq UTSW 16 37041747 missense probably damaging 1.00
R1398:Polq UTSW 16 37062495 missense possibly damaging 0.87
R1424:Polq UTSW 16 37086528 missense probably damaging 1.00
R1644:Polq UTSW 16 37060264 missense probably damaging 0.96
R1777:Polq UTSW 16 37060224 missense possibly damaging 0.94
R1820:Polq UTSW 16 37029418 missense possibly damaging 0.48
R1854:Polq UTSW 16 37062109 missense probably benign 0.01
R1880:Polq UTSW 16 37086592 missense possibly damaging 0.90
R1932:Polq UTSW 16 37062304 missense possibly damaging 0.92
R2008:Polq UTSW 16 37062482 missense probably damaging 0.96
R2014:Polq UTSW 16 37078366 missense probably damaging 1.00
R2026:Polq UTSW 16 37062745 missense possibly damaging 0.93
R2178:Polq UTSW 16 37062829 missense probably damaging 1.00
R2259:Polq UTSW 16 37062097 missense probably benign 0.03
R2266:Polq UTSW 16 37062153 missense possibly damaging 0.59
R2305:Polq UTSW 16 37062337 missense probably damaging 0.99
R2370:Polq UTSW 16 37073939 missense probably damaging 1.00
R2504:Polq UTSW 16 37011942 missense unknown
R2517:Polq UTSW 16 37089325 missense probably damaging 1.00
R2697:Polq UTSW 16 37042153 missense probably damaging 1.00
R2858:Polq UTSW 16 37062753 missense possibly damaging 0.88
R3436:Polq UTSW 16 37062337 missense probably damaging 0.99
R3437:Polq UTSW 16 37062337 missense probably damaging 0.99
R3699:Polq UTSW 16 37042156 missense probably damaging 1.00
R3838:Polq UTSW 16 37078349 missense probably damaging 1.00
R3875:Polq UTSW 16 37074027 missense probably damaging 0.99
R4050:Polq UTSW 16 37092820 critical splice acceptor site probably null
R4172:Polq UTSW 16 37060758 missense probably benign 0.02
R4238:Polq UTSW 16 37013181 missense probably damaging 1.00
R4240:Polq UTSW 16 37013181 missense probably damaging 1.00
R4280:Polq UTSW 16 37082057 missense probably damaging 1.00
R4296:Polq UTSW 16 37061301 missense possibly damaging 0.94
R4360:Polq UTSW 16 37060339 missense probably benign 0.00
R4373:Polq UTSW 16 37013181 missense probably damaging 1.00
R4375:Polq UTSW 16 37013181 missense probably damaging 1.00
R4376:Polq UTSW 16 37013181 missense probably damaging 1.00
R4509:Polq UTSW 16 37048563 missense probably damaging 1.00
R4510:Polq UTSW 16 37048563 missense probably damaging 1.00
R4511:Polq UTSW 16 37048563 missense probably damaging 1.00
R4543:Polq UTSW 16 37060785 missense probably benign 0.43
R4633:Polq UTSW 16 37048542 missense probably damaging 1.00
R4739:Polq UTSW 16 37041747 missense probably damaging 1.00
R4834:Polq UTSW 16 37027814 missense probably damaging 1.00
R4841:Polq UTSW 16 37048783 critical splice donor site probably null
R4842:Polq UTSW 16 37048783 critical splice donor site probably null
R4937:Polq UTSW 16 37027912 missense probably benign 0.01
R4955:Polq UTSW 16 37061082 missense probably benign 0.32
R4992:Polq UTSW 16 37061162 missense possibly damaging 0.59
R5008:Polq UTSW 16 37062387 missense probably benign
R5221:Polq UTSW 16 37042178 missense probably damaging 0.98
R5254:Polq UTSW 16 37089319 missense probably damaging 1.00
R5292:Polq UTSW 16 37061383 missense probably damaging 1.00
R5375:Polq UTSW 16 37082784 missense probably damaging 1.00
R5480:Polq UTSW 16 37013290 splice site probably benign
R5552:Polq UTSW 16 37094510 missense possibly damaging 0.93
R5591:Polq UTSW 16 37011885 utr 5 prime probably benign
R5653:Polq UTSW 16 37040534 missense probably damaging 1.00
R5708:Polq UTSW 16 37061018 missense probably damaging 0.98
R5754:Polq UTSW 16 37017263 missense probably benign
R5757:Polq UTSW 16 37086681 missense probably benign 0.01
R5764:Polq UTSW 16 37017344 missense probably damaging 0.97
R6019:Polq UTSW 16 37061764 missense probably damaging 1.00
R6170:Polq UTSW 16 37045812 missense possibly damaging 0.82
R6177:Polq UTSW 16 37071709 missense probably damaging 0.98
R6307:Polq UTSW 16 37017356 critical splice donor site probably null
R6520:Polq UTSW 16 37060377 missense possibly damaging 0.88
R6598:Polq UTSW 16 37061631 missense probably benign 0.39
R6694:Polq UTSW 16 37015173 missense probably null 0.99
R6788:Polq UTSW 16 37077148 missense probably damaging 1.00
R7104:Polq UTSW 16 37089353 nonsense probably null
R7159:Polq UTSW 16 37062853 missense possibly damaging 0.87
R7222:Polq UTSW 16 37086633 nonsense probably null
R7340:Polq UTSW 16 37060926 missense probably benign 0.00
R7361:Polq UTSW 16 37060428 missense probably benign 0.00
R7384:Polq UTSW 16 37029418 missense probably damaging 1.00
R7509:Polq UTSW 16 37060343 missense probably benign
R7509:Polq UTSW 16 37060344 missense probably benign 0.00
R7575:Polq UTSW 16 37091134 missense probably benign 0.00
R7785:Polq UTSW 16 37027877 missense probably damaging 1.00
R7787:Polq UTSW 16 37017309 missense probably damaging 1.00
R7891:Polq UTSW 16 37027882 missense probably damaging 1.00
R7898:Polq UTSW 16 37044883 missense probably damaging 0.98
R7917:Polq UTSW 16 37065288 missense probably benign 0.08
R7940:Polq UTSW 16 37060642 missense probably benign 0.27
R8028:Polq UTSW 16 37061316 missense possibly damaging 0.82
R8114:Polq UTSW 16 37042215 missense possibly damaging 0.94
R8144:Polq UTSW 16 37029484 missense probably benign 0.01
R8288:Polq UTSW 16 37027910 missense probably damaging 1.00
R8301:Polq UTSW 16 37061819 missense probably damaging 1.00
R8341:Polq UTSW 16 37071771 missense possibly damaging 0.96
R8348:Polq UTSW 16 37017197 critical splice acceptor site probably null
R8448:Polq UTSW 16 37017197 critical splice acceptor site probably null
R8815:Polq UTSW 16 37033531 missense probably damaging 1.00
R8843:Polq UTSW 16 37011918 missense unknown
R8878:Polq UTSW 16 37040507 missense probably benign 0.02
R9016:Polq UTSW 16 37022797 missense probably damaging 1.00
R9189:Polq UTSW 16 37044903 missense probably damaging 1.00
R9209:Polq UTSW 16 37048649 missense possibly damaging 0.94
R9352:Polq UTSW 16 37041890 missense probably damaging 0.98
R9398:Polq UTSW 16 37061032 missense probably benign 0.02
R9403:Polq UTSW 16 37061853 missense probably benign 0.00
R9489:Polq UTSW 16 37022811 missense probably benign 0.00
X0060:Polq UTSW 16 37017237 nonsense probably null
Z1176:Polq UTSW 16 37042257 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTAGTCCTGTGCGTGACTC -3'
(R):5'- TTCTCACTGTGGTATTCCAGGTAC -3'

Sequencing Primer
(F):5'- CGTGACTCTGGGATGCATAGAG -3'
(R):5'- AGGTACTGGCTGACTGGGTAG -3'
Posted On 2018-06-06