Incidental Mutation 'R6499:B4galt4'
ID519649
Institutional Source Beutler Lab
Gene Symbol B4galt4
Ensembl Gene ENSMUSG00000022793
Gene NameUDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R6499 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location38742264-38769049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38757822 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 210 (D210E)
Ref Sequence ENSEMBL: ENSMUSP00000110360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023482] [ENSMUST00000114708] [ENSMUST00000114710] [ENSMUST00000114711] [ENSMUST00000114712] [ENSMUST00000154902] [ENSMUST00000231655] [ENSMUST00000232454]
Predicted Effect probably benign
Transcript: ENSMUST00000023482
AA Change: D210E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000023482
Gene: ENSMUSG00000022793
AA Change: D210E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Glyco_transf_7N 77 209 8.4e-63 PFAM
Pfam:Glyco_transf_7C 213 290 1e-30 PFAM
Pfam:Glyco_tranf_2_2 224 289 2.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114708
SMART Domains Protein: ENSMUSP00000110356
Gene: ENSMUSG00000022793

DomainStartEndE-ValueType
SCOP:d1j8wb_ 1 71 2e-30 SMART
PDB:2FYD|D 1 73 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114710
SMART Domains Protein: ENSMUSP00000110358
Gene: ENSMUSG00000022793

DomainStartEndE-ValueType
SCOP:d1j8wb_ 1 71 2e-30 SMART
PDB:2FYD|D 1 73 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114711
SMART Domains Protein: ENSMUSP00000110359
Gene: ENSMUSG00000022793

DomainStartEndE-ValueType
SCOP:d1j8wb_ 1 71 2e-30 SMART
PDB:2FYD|D 1 73 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114712
AA Change: D210E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110360
Gene: ENSMUSG00000022793
AA Change: D210E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Glyco_transf_7N 77 211 6.2e-58 PFAM
Pfam:Glyco_transf_7C 213 290 6.9e-31 PFAM
Pfam:Glyco_tranf_2_2 224 289 3.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154902
AA Change: D210E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118593
Gene: ENSMUSG00000022793
AA Change: D210E

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Glyco_transf_7N 77 211 5.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231655
Predicted Effect probably benign
Transcript: ENSMUST00000232454
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene appears to mainly play a role in glycolipid biosynthesis. Two alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in B4galt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:B4galt4 APN 16 38754144 missense probably damaging 1.00
IGL01414:B4galt4 APN 16 38757791 missense probably damaging 1.00
R0831:B4galt4 UTSW 16 38767979 missense probably benign 0.01
R2125:B4galt4 UTSW 16 38765938 missense probably damaging 0.99
R3950:B4galt4 UTSW 16 38768022 missense probably benign
R4334:B4galt4 UTSW 16 38752259 missense probably damaging 0.99
R4773:B4galt4 UTSW 16 38752296 missense probably benign 0.37
R6706:B4galt4 UTSW 16 38757811 missense probably benign 0.06
R7208:B4galt4 UTSW 16 38753940 missense probably damaging 1.00
R7500:B4galt4 UTSW 16 38768014 missense probably damaging 1.00
R7548:B4galt4 UTSW 16 38754066 missense probably damaging 1.00
R7792:B4galt4 UTSW 16 38757810 nonsense probably null
R8058:B4galt4 UTSW 16 38766021 critical splice donor site probably null
R8202:B4galt4 UTSW 16 38767912 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACCCTAGAGTATGTTGTCTTG -3'
(R):5'- TGCTGCTCTGCACATTAAGG -3'

Sequencing Primer
(F):5'- TAACACTCCTAAATGGCGGTG -3'
(R):5'- CATTAAGGGAAAATGGGCGTCTTTCC -3'
Posted On2018-06-06