Incidental Mutation 'R6499:Psmg1'
ID519650
Institutional Source Beutler Lab
Gene Symbol Psmg1
Ensembl Gene ENSMUSG00000022913
Gene Nameproteasome (prosome, macropain) assembly chaperone 1
SynonymsDscr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6499 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location95979954-95990903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95988097 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 87 (F87L)
Ref Sequence ENSEMBL: ENSMUSP00000113102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023630] [ENSMUST00000023631] [ENSMUST00000099502] [ENSMUST00000117044] [ENSMUST00000149066]
Predicted Effect probably damaging
Transcript: ENSMUST00000023630
AA Change: F87L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000023631
SMART Domains Protein: ENSMUSP00000023631
Gene: ENSMUSG00000022914

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099502
SMART Domains Protein: ENSMUSP00000097101
Gene: ENSMUSG00000022914

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117044
AA Change: F87L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000149066
AA Change: V51A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele die by E6.5. Mice homozygous for a conditional allele activated in the brain exhibit abnormal brain development, neurological defects, and die by P21. Mice homozygous for a conditional allele activated in the liver exhibit premature hepatocyte senescence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Psmg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Psmg1 APN 16 95980068 missense possibly damaging 0.83
IGL01585:Psmg1 APN 16 95988021 missense possibly damaging 0.94
IGL02597:Psmg1 APN 16 95987297 missense probably damaging 1.00
R0306:Psmg1 UTSW 16 95987340 missense probably damaging 1.00
R0362:Psmg1 UTSW 16 95987971 missense possibly damaging 0.91
R0506:Psmg1 UTSW 16 95989487 unclassified probably benign
R2566:Psmg1 UTSW 16 95982195 nonsense probably null
R3014:Psmg1 UTSW 16 95980048 missense probably damaging 1.00
R4944:Psmg1 UTSW 16 95989612 unclassified probably benign
R5048:Psmg1 UTSW 16 95983971 missense probably benign 0.34
R5771:Psmg1 UTSW 16 95982169 missense probably damaging 1.00
R6086:Psmg1 UTSW 16 95980044 missense probably damaging 1.00
X0066:Psmg1 UTSW 16 95987320 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TGAGAATCTGCTTACTATCGAGG -3'
(R):5'- TAGAGTTGCGAGTCACCAGG -3'

Sequencing Primer
(F):5'- GCTCGTGCCTACATGACCATG -3'
(R):5'- CGAGTCACCAGGGGGAG -3'
Posted On2018-06-06