Incidental Mutation 'R6499:Wdr55'
ID519651
Institutional Source Beutler Lab
Gene Symbol Wdr55
Ensembl Gene ENSMUSG00000042660
Gene NameWD repeat domain 55
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6499 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location36760239-36763708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36762178 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 103 (V103A)
Ref Sequence ENSEMBL: ENSMUSP00000039010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001416] [ENSMUST00000007042] [ENSMUST00000049323] [ENSMUST00000061522]
Predicted Effect probably benign
Transcript: ENSMUST00000001416
SMART Domains Protein: ENSMUSP00000001416
Gene: ENSMUSG00000001380

DomainStartEndE-ValueType
WHEP-TRS 7 60 5.37e-11 SMART
Pfam:tRNA-synt_His 61 389 1.9e-41 PFAM
Pfam:HGTP_anticodon2 404 507 3.3e-12 PFAM
Pfam:HGTP_anticodon 410 501 4.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000007042
SMART Domains Protein: ENSMUSP00000007042
Gene: ENSMUSG00000024474

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:RED_N 76 302 1.6e-105 PFAM
low complexity region 334 380 N/A INTRINSIC
Pfam:RED_C 445 554 1.1e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049323
AA Change: V103A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039010
Gene: ENSMUSG00000042660
AA Change: V103A

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
WD40 31 67 4.6e0 SMART
WD40 74 113 1.12e-2 SMART
WD40 116 155 2.4e-2 SMART
WD40 158 197 2.76e-2 SMART
WD40 202 239 1.72e0 SMART
WD40 284 324 2.01e-4 SMART
low complexity region 380 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061522
SMART Domains Protein: ENSMUSP00000054412
Gene: ENSMUSG00000044595

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
RRM 59 132 2.49e-10 SMART
RRM 139 214 3.01e-1 SMART
Pfam:DND1_DSRM 253 333 1.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224284
Meta Mutation Damage Score 0.0639 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Rbm27 T A 18: 42,337,011 W958R probably damaging Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Wdr55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Wdr55 APN 18 36762079 critical splice donor site probably null
IGL02720:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02723:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02726:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02728:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02729:Wdr55 APN 18 36763382 missense probably benign 0.12
IGL02731:Wdr55 APN 18 36763382 missense probably benign 0.12
R1420:Wdr55 UTSW 18 36760339 missense probably benign 0.00
R1952:Wdr55 UTSW 18 36760384 missense probably damaging 1.00
R2143:Wdr55 UTSW 18 36762366 missense possibly damaging 0.95
R2144:Wdr55 UTSW 18 36762366 missense possibly damaging 0.95
R4323:Wdr55 UTSW 18 36763100 missense probably benign 0.00
R4497:Wdr55 UTSW 18 36760395 missense possibly damaging 0.85
R4937:Wdr55 UTSW 18 36762398 missense probably benign 0.00
R5662:Wdr55 UTSW 18 36760395 missense possibly damaging 0.85
R6315:Wdr55 UTSW 18 36762069 missense probably damaging 1.00
R6679:Wdr55 UTSW 18 36763124 missense probably damaging 1.00
R7038:Wdr55 UTSW 18 36760420 missense probably damaging 1.00
R7151:Wdr55 UTSW 18 36762936 missense possibly damaging 0.48
R7687:Wdr55 UTSW 18 36762023 missense probably damaging 1.00
R7808:Wdr55 UTSW 18 36760416 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTGCCTACTCTTGTCAGGAGG -3'
(R):5'- AGCAGCACACTGTTAATGGG -3'

Sequencing Primer
(F):5'- CTACTCTTGTCAGGAGGGAGAAACC -3'
(R):5'- CACACTGTTAATGGGGGCACTG -3'
Posted On2018-06-06