Incidental Mutation 'R6499:Wdr55'
ID 519651
Institutional Source Beutler Lab
Gene Symbol Wdr55
Ensembl Gene ENSMUSG00000042660
Gene Name WD repeat domain 55
Synonyms 2410080P20Rik
MMRRC Submission 044631-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6499 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 36893275-36896761 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36895231 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 103 (V103A)
Ref Sequence ENSEMBL: ENSMUSP00000039010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001416] [ENSMUST00000007042] [ENSMUST00000049323] [ENSMUST00000061522]
AlphaFold Q9CX97
Predicted Effect probably benign
Transcript: ENSMUST00000001416
SMART Domains Protein: ENSMUSP00000001416
Gene: ENSMUSG00000001380

DomainStartEndE-ValueType
WHEP-TRS 7 60 5.37e-11 SMART
Pfam:tRNA-synt_His 61 389 1.9e-41 PFAM
Pfam:HGTP_anticodon2 404 507 3.3e-12 PFAM
Pfam:HGTP_anticodon 410 501 4.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000007042
SMART Domains Protein: ENSMUSP00000007042
Gene: ENSMUSG00000024474

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:RED_N 76 302 1.6e-105 PFAM
low complexity region 334 380 N/A INTRINSIC
Pfam:RED_C 445 554 1.1e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049323
AA Change: V103A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039010
Gene: ENSMUSG00000042660
AA Change: V103A

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
WD40 31 67 4.6e0 SMART
WD40 74 113 1.12e-2 SMART
WD40 116 155 2.4e-2 SMART
WD40 158 197 2.76e-2 SMART
WD40 202 239 1.72e0 SMART
WD40 284 324 2.01e-4 SMART
low complexity region 380 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000061522
SMART Domains Protein: ENSMUSP00000054412
Gene: ENSMUSG00000044595

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
RRM 59 132 2.49e-10 SMART
RRM 139 214 3.01e-1 SMART
Pfam:DND1_DSRM 253 333 1.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224284
Meta Mutation Damage Score 0.0639 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,774,561 (GRCm39) T1250M probably damaging Het
Actn1 C T 12: 80,215,191 (GRCm39) A857T possibly damaging Het
Adam2 C T 14: 66,296,239 (GRCm39) V207I probably damaging Het
Angpt2 T C 8: 18,744,533 (GRCm39) T404A probably benign Het
Ank3 T C 10: 69,827,574 (GRCm39) probably benign Het
Atosa C A 9: 74,930,930 (GRCm39) Q958K probably damaging Het
B4galt4 T A 16: 38,578,184 (GRCm39) D210E probably benign Het
Brinp3 A T 1: 146,777,431 (GRCm39) H626L possibly damaging Het
Ccna2 T G 3: 36,625,112 (GRCm39) D68A probably damaging Het
Cd163 G A 6: 124,281,703 (GRCm39) G2D probably benign Het
Chrm5 A T 2: 112,310,825 (GRCm39) V97D probably benign Het
Dctn5 G A 7: 121,734,320 (GRCm39) V55I probably benign Het
Dnm3 A T 1: 162,141,164 (GRCm39) I365N probably damaging Het
Esyt2 A G 12: 116,284,790 (GRCm39) D184G probably damaging Het
Ifi214 C A 1: 173,352,597 (GRCm39) K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 (GRCm39) P169L probably benign Het
Inhbb C T 1: 119,345,069 (GRCm39) E407K probably damaging Het
Lama2 T A 10: 26,907,154 (GRCm39) T2336S probably damaging Het
Ldhb A T 6: 142,439,847 (GRCm39) V231E possibly damaging Het
Lrit2 T C 14: 36,790,767 (GRCm39) F149L probably damaging Het
Malrd1 T A 2: 15,936,500 (GRCm39) S1575T probably benign Het
Naip5 A G 13: 100,358,102 (GRCm39) C1045R probably benign Het
Nefl A G 14: 68,322,034 (GRCm39) E208G probably damaging Het
Oog4 A C 4: 143,164,548 (GRCm39) S328A probably damaging Het
Or1e1 T A 11: 73,245,011 (GRCm39) L144Q probably damaging Het
Or5p79 G T 7: 108,221,713 (GRCm39) M231I probably benign Het
Or6c216 T C 10: 129,678,453 (GRCm39) I153V probably benign Het
Or7e168 A G 9: 19,719,847 (GRCm39) I78V probably benign Het
Pbrm1 A G 14: 30,783,466 (GRCm39) N528D probably damaging Het
Pls1 A G 9: 95,636,798 (GRCm39) I558T probably damaging Het
Polq T C 16: 36,881,189 (GRCm39) S839P probably benign Het
Psmg1 A G 16: 95,789,297 (GRCm39) F87L probably damaging Het
Ptprt A G 2: 161,376,507 (GRCm39) M1298T probably benign Het
Rbm27 T A 18: 42,470,076 (GRCm39) W958R probably damaging Het
Skint5 T G 4: 113,396,552 (GRCm39) D1207A unknown Het
Stx17 T A 4: 48,183,478 (GRCm39) probably null Het
Tas2r114 A T 6: 131,666,099 (GRCm39) *310R probably null Het
Tmem130 T A 5: 144,689,224 (GRCm39) N139I probably damaging Het
Trpc1 T C 9: 95,608,490 (GRCm39) E267G probably damaging Het
Trrap T A 5: 144,793,812 (GRCm39) M3398K probably damaging Het
Vrtn T G 12: 84,697,090 (GRCm39) D613E probably benign Het
Vsx1 G T 2: 150,530,441 (GRCm39) T147K probably benign Het
Zfp712 A T 13: 67,200,400 (GRCm39) D28E probably benign Het
Other mutations in Wdr55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Wdr55 APN 18 36,895,132 (GRCm39) critical splice donor site probably null
IGL02720:Wdr55 APN 18 36,896,435 (GRCm39) missense probably benign 0.12
IGL02723:Wdr55 APN 18 36,896,435 (GRCm39) missense probably benign 0.12
IGL02726:Wdr55 APN 18 36,896,435 (GRCm39) missense probably benign 0.12
IGL02728:Wdr55 APN 18 36,896,435 (GRCm39) missense probably benign 0.12
IGL02729:Wdr55 APN 18 36,896,435 (GRCm39) missense probably benign 0.12
IGL02731:Wdr55 APN 18 36,896,435 (GRCm39) missense probably benign 0.12
R1420:Wdr55 UTSW 18 36,893,392 (GRCm39) missense probably benign 0.00
R1952:Wdr55 UTSW 18 36,893,437 (GRCm39) missense probably damaging 1.00
R2143:Wdr55 UTSW 18 36,895,419 (GRCm39) missense possibly damaging 0.95
R2144:Wdr55 UTSW 18 36,895,419 (GRCm39) missense possibly damaging 0.95
R4323:Wdr55 UTSW 18 36,896,153 (GRCm39) missense probably benign 0.00
R4497:Wdr55 UTSW 18 36,893,448 (GRCm39) missense possibly damaging 0.85
R4937:Wdr55 UTSW 18 36,895,451 (GRCm39) missense probably benign 0.00
R5662:Wdr55 UTSW 18 36,893,448 (GRCm39) missense possibly damaging 0.85
R6315:Wdr55 UTSW 18 36,895,122 (GRCm39) missense probably damaging 1.00
R6679:Wdr55 UTSW 18 36,896,177 (GRCm39) missense probably damaging 1.00
R7038:Wdr55 UTSW 18 36,893,473 (GRCm39) missense probably damaging 1.00
R7151:Wdr55 UTSW 18 36,895,989 (GRCm39) missense possibly damaging 0.48
R7687:Wdr55 UTSW 18 36,895,076 (GRCm39) missense probably damaging 1.00
R7808:Wdr55 UTSW 18 36,893,469 (GRCm39) missense probably benign 0.04
R9365:Wdr55 UTSW 18 36,893,354 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGCCTACTCTTGTCAGGAGG -3'
(R):5'- AGCAGCACACTGTTAATGGG -3'

Sequencing Primer
(F):5'- CTACTCTTGTCAGGAGGGAGAAACC -3'
(R):5'- CACACTGTTAATGGGGGCACTG -3'
Posted On 2018-06-06