Incidental Mutation 'R6499:Rbm27'
ID 519652
Institutional Source Beutler Lab
Gene Symbol Rbm27
Ensembl Gene ENSMUSG00000024491
Gene Name RNA binding motif protein 27
Synonyms Psc1
MMRRC Submission 044631-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6499 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 42408418-42474607 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 42470076 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 958 (W958R)
Ref Sequence ENSEMBL: ENSMUSP00000089540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046972] [ENSMUST00000091920]
AlphaFold Q5SFM8
Predicted Effect probably damaging
Transcript: ENSMUST00000046972
AA Change: W914R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041688
Gene: ENSMUSG00000024491
AA Change: W914R

DomainStartEndE-ValueType
Pfam:PWI 7 77 1.4e-10 PFAM
low complexity region 78 105 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 163 188 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
Pfam:zf-CCCH 274 300 5.2e-7 PFAM
low complexity region 317 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 448 462 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
SCOP:d1l3ka2 598 638 1e-4 SMART
Blast:RRM 601 643 2e-11 BLAST
Blast:RRM_2 744 782 3e-6 BLAST
low complexity region 783 798 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 945 953 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091920
AA Change: W958R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089540
Gene: ENSMUSG00000024491
AA Change: W958R

DomainStartEndE-ValueType
Pfam:PWI 7 77 1.5e-10 PFAM
low complexity region 78 105 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 163 188 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
Pfam:zf-CCCH 274 300 5.5e-7 PFAM
low complexity region 317 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
RRM 546 615 7.94e-3 SMART
low complexity region 623 658 N/A INTRINSIC
Blast:RRM_2 788 826 3e-6 BLAST
low complexity region 827 842 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
low complexity region 968 982 N/A INTRINSIC
low complexity region 989 997 N/A INTRINSIC
Meta Mutation Damage Score 0.8598 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 137,774,561 (GRCm39) T1250M probably damaging Het
Actn1 C T 12: 80,215,191 (GRCm39) A857T possibly damaging Het
Adam2 C T 14: 66,296,239 (GRCm39) V207I probably damaging Het
Angpt2 T C 8: 18,744,533 (GRCm39) T404A probably benign Het
Ank3 T C 10: 69,827,574 (GRCm39) probably benign Het
Atosa C A 9: 74,930,930 (GRCm39) Q958K probably damaging Het
B4galt4 T A 16: 38,578,184 (GRCm39) D210E probably benign Het
Brinp3 A T 1: 146,777,431 (GRCm39) H626L possibly damaging Het
Ccna2 T G 3: 36,625,112 (GRCm39) D68A probably damaging Het
Cd163 G A 6: 124,281,703 (GRCm39) G2D probably benign Het
Chrm5 A T 2: 112,310,825 (GRCm39) V97D probably benign Het
Dctn5 G A 7: 121,734,320 (GRCm39) V55I probably benign Het
Dnm3 A T 1: 162,141,164 (GRCm39) I365N probably damaging Het
Esyt2 A G 12: 116,284,790 (GRCm39) D184G probably damaging Het
Ifi214 C A 1: 173,352,597 (GRCm39) K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 (GRCm39) P169L probably benign Het
Inhbb C T 1: 119,345,069 (GRCm39) E407K probably damaging Het
Lama2 T A 10: 26,907,154 (GRCm39) T2336S probably damaging Het
Ldhb A T 6: 142,439,847 (GRCm39) V231E possibly damaging Het
Lrit2 T C 14: 36,790,767 (GRCm39) F149L probably damaging Het
Malrd1 T A 2: 15,936,500 (GRCm39) S1575T probably benign Het
Naip5 A G 13: 100,358,102 (GRCm39) C1045R probably benign Het
Nefl A G 14: 68,322,034 (GRCm39) E208G probably damaging Het
Oog4 A C 4: 143,164,548 (GRCm39) S328A probably damaging Het
Or1e1 T A 11: 73,245,011 (GRCm39) L144Q probably damaging Het
Or5p79 G T 7: 108,221,713 (GRCm39) M231I probably benign Het
Or6c216 T C 10: 129,678,453 (GRCm39) I153V probably benign Het
Or7e168 A G 9: 19,719,847 (GRCm39) I78V probably benign Het
Pbrm1 A G 14: 30,783,466 (GRCm39) N528D probably damaging Het
Pls1 A G 9: 95,636,798 (GRCm39) I558T probably damaging Het
Polq T C 16: 36,881,189 (GRCm39) S839P probably benign Het
Psmg1 A G 16: 95,789,297 (GRCm39) F87L probably damaging Het
Ptprt A G 2: 161,376,507 (GRCm39) M1298T probably benign Het
Skint5 T G 4: 113,396,552 (GRCm39) D1207A unknown Het
Stx17 T A 4: 48,183,478 (GRCm39) probably null Het
Tas2r114 A T 6: 131,666,099 (GRCm39) *310R probably null Het
Tmem130 T A 5: 144,689,224 (GRCm39) N139I probably damaging Het
Trpc1 T C 9: 95,608,490 (GRCm39) E267G probably damaging Het
Trrap T A 5: 144,793,812 (GRCm39) M3398K probably damaging Het
Vrtn T G 12: 84,697,090 (GRCm39) D613E probably benign Het
Vsx1 G T 2: 150,530,441 (GRCm39) T147K probably benign Het
Wdr55 T C 18: 36,895,231 (GRCm39) V103A probably benign Het
Zfp712 A T 13: 67,200,400 (GRCm39) D28E probably benign Het
Other mutations in Rbm27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Rbm27 APN 18 42,452,879 (GRCm39) missense possibly damaging 0.82
IGL01630:Rbm27 APN 18 42,434,905 (GRCm39) missense probably damaging 1.00
IGL02045:Rbm27 APN 18 42,452,978 (GRCm39) missense possibly damaging 0.52
IGL03031:Rbm27 APN 18 42,466,464 (GRCm39) critical splice donor site probably null
IGL03085:Rbm27 APN 18 42,460,589 (GRCm39) splice site probably benign
IGL03249:Rbm27 APN 18 42,434,812 (GRCm39) missense probably damaging 0.99
IGL03372:Rbm27 APN 18 42,438,781 (GRCm39) missense probably damaging 0.99
messenger UTSW 18 42,466,468 (GRCm39) splice site probably null
R0048:Rbm27 UTSW 18 42,431,529 (GRCm39) missense probably benign 0.02
R0048:Rbm27 UTSW 18 42,431,529 (GRCm39) missense probably benign 0.02
R0111:Rbm27 UTSW 18 42,438,737 (GRCm39) splice site probably benign
R0122:Rbm27 UTSW 18 42,447,033 (GRCm39) intron probably benign
R0707:Rbm27 UTSW 18 42,459,091 (GRCm39) critical splice donor site probably null
R1253:Rbm27 UTSW 18 42,434,839 (GRCm39) missense probably damaging 0.99
R1268:Rbm27 UTSW 18 42,466,367 (GRCm39) missense probably damaging 1.00
R1317:Rbm27 UTSW 18 42,457,116 (GRCm39) splice site probably benign
R1403:Rbm27 UTSW 18 42,450,746 (GRCm39) missense probably damaging 0.97
R1403:Rbm27 UTSW 18 42,450,746 (GRCm39) missense probably damaging 0.97
R2187:Rbm27 UTSW 18 42,459,022 (GRCm39) missense probably damaging 1.00
R2358:Rbm27 UTSW 18 42,425,177 (GRCm39) splice site probably benign
R3123:Rbm27 UTSW 18 42,460,230 (GRCm39) missense probably damaging 1.00
R3711:Rbm27 UTSW 18 42,425,177 (GRCm39) splice site probably benign
R3712:Rbm27 UTSW 18 42,425,177 (GRCm39) splice site probably benign
R4616:Rbm27 UTSW 18 42,434,840 (GRCm39) missense probably damaging 0.96
R4839:Rbm27 UTSW 18 42,460,510 (GRCm39) missense probably damaging 1.00
R5151:Rbm27 UTSW 18 42,471,509 (GRCm39) missense probably damaging 1.00
R5308:Rbm27 UTSW 18 42,460,275 (GRCm39) missense probably damaging 1.00
R5696:Rbm27 UTSW 18 42,450,731 (GRCm39) missense probably damaging 1.00
R5868:Rbm27 UTSW 18 42,433,450 (GRCm39) missense possibly damaging 0.86
R6058:Rbm27 UTSW 18 42,460,570 (GRCm39) missense probably damaging 1.00
R6477:Rbm27 UTSW 18 42,466,383 (GRCm39) missense probably damaging 1.00
R6658:Rbm27 UTSW 18 42,457,178 (GRCm39) missense probably damaging 1.00
R6700:Rbm27 UTSW 18 42,459,004 (GRCm39) missense probably damaging 1.00
R6784:Rbm27 UTSW 18 42,434,929 (GRCm39) missense probably benign 0.00
R6812:Rbm27 UTSW 18 42,466,468 (GRCm39) splice site probably null
R7162:Rbm27 UTSW 18 42,447,092 (GRCm39) missense unknown
R7606:Rbm27 UTSW 18 42,460,578 (GRCm39) missense probably damaging 1.00
R7904:Rbm27 UTSW 18 42,465,921 (GRCm39) missense probably damaging 1.00
R7969:Rbm27 UTSW 18 42,408,545 (GRCm39) start gained probably benign
R8177:Rbm27 UTSW 18 42,457,175 (GRCm39) missense probably damaging 1.00
R9052:Rbm27 UTSW 18 42,465,893 (GRCm39) missense probably damaging 1.00
R9091:Rbm27 UTSW 18 42,438,829 (GRCm39) missense probably benign 0.06
R9206:Rbm27 UTSW 18 42,447,163 (GRCm39) nonsense probably null
R9269:Rbm27 UTSW 18 42,460,572 (GRCm39) missense probably benign 0.02
R9270:Rbm27 UTSW 18 42,438,829 (GRCm39) missense probably benign 0.06
R9680:Rbm27 UTSW 18 42,455,186 (GRCm39) missense probably damaging 0.98
X0065:Rbm27 UTSW 18 42,432,385 (GRCm39) missense possibly damaging 0.70
Z1176:Rbm27 UTSW 18 42,466,299 (GRCm39) frame shift probably null
Z1177:Rbm27 UTSW 18 42,471,517 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGTCACTTTGCTCAGTAGTG -3'
(R):5'- GCTAACCTACTAAAAGGAAAGTGAC -3'

Sequencing Primer
(F):5'- GACCAAATATAGGCGTGTCTTAGCTG -3'
(R):5'- AAGGAAAGTGACACTATTCTATATGC -3'
Posted On 2018-06-06