Incidental Mutation 'R6499:Rbm27'
ID519652
Institutional Source Beutler Lab
Gene Symbol Rbm27
Ensembl Gene ENSMUSG00000024491
Gene NameRNA binding motif protein 27
SynonymsPsc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6499 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location42275353-42341542 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42337011 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 958 (W958R)
Ref Sequence ENSEMBL: ENSMUSP00000089540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046972] [ENSMUST00000091920]
Predicted Effect probably damaging
Transcript: ENSMUST00000046972
AA Change: W914R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041688
Gene: ENSMUSG00000024491
AA Change: W914R

DomainStartEndE-ValueType
Pfam:PWI 7 77 1.4e-10 PFAM
low complexity region 78 105 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 163 188 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
Pfam:zf-CCCH 274 300 5.2e-7 PFAM
low complexity region 317 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 448 462 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
SCOP:d1l3ka2 598 638 1e-4 SMART
Blast:RRM 601 643 2e-11 BLAST
Blast:RRM_2 744 782 3e-6 BLAST
low complexity region 783 798 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 945 953 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091920
AA Change: W958R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089540
Gene: ENSMUSG00000024491
AA Change: W958R

DomainStartEndE-ValueType
Pfam:PWI 7 77 1.5e-10 PFAM
low complexity region 78 105 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 144 158 N/A INTRINSIC
low complexity region 163 188 N/A INTRINSIC
low complexity region 213 235 N/A INTRINSIC
low complexity region 255 268 N/A INTRINSIC
Pfam:zf-CCCH 274 300 5.5e-7 PFAM
low complexity region 317 358 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
low complexity region 486 500 N/A INTRINSIC
RRM 546 615 7.94e-3 SMART
low complexity region 623 658 N/A INTRINSIC
Blast:RRM_2 788 826 3e-6 BLAST
low complexity region 827 842 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
low complexity region 968 982 N/A INTRINSIC
low complexity region 989 997 N/A INTRINSIC
Meta Mutation Damage Score 0.8598 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik C T 3: 138,068,800 T1250M probably damaging Het
Actn1 C T 12: 80,168,417 A857T possibly damaging Het
Adam2 C T 14: 66,058,790 V207I probably damaging Het
Angpt2 T C 8: 18,694,517 T404A probably benign Het
Ank3 T C 10: 69,991,744 probably benign Het
B4galt4 T A 16: 38,757,822 D210E probably benign Het
Brinp3 A T 1: 146,901,693 H626L possibly damaging Het
Ccna2 T G 3: 36,570,963 D68A probably damaging Het
Cd163 G A 6: 124,304,744 G2D probably benign Het
Chrm5 A T 2: 112,480,480 V97D probably benign Het
Dctn5 G A 7: 122,135,097 V55I probably benign Het
Dnm3 A T 1: 162,313,595 I365N probably damaging Het
Esyt2 A G 12: 116,321,170 D184G probably damaging Het
Fam214a C A 9: 75,023,648 Q958K probably damaging Het
Ifi214 C A 1: 173,525,031 K277N probably damaging Het
Il11ra1 C T 4: 41,765,412 P169L probably benign Het
Inhbb C T 1: 119,417,339 E407K probably damaging Het
Lama2 T A 10: 27,031,158 T2336S probably damaging Het
Ldhb A T 6: 142,494,121 V231E possibly damaging Het
Lrit2 T C 14: 37,068,810 F149L probably damaging Het
Malrd1 T A 2: 15,931,689 S1575T probably benign Het
Naip5 A G 13: 100,221,594 C1045R probably benign Het
Nefl A G 14: 68,084,585 E208G probably damaging Het
Olfr20 T A 11: 73,354,185 L144Q probably damaging Het
Olfr507 G T 7: 108,622,506 M231I probably benign Het
Olfr812 T C 10: 129,842,584 I153V probably benign Het
Olfr859 A G 9: 19,808,551 I78V probably benign Het
Oog4 A C 4: 143,437,978 S328A probably damaging Het
Pbrm1 A G 14: 31,061,509 N528D probably damaging Het
Pls1 A G 9: 95,754,745 I558T probably damaging Het
Polq T C 16: 37,060,827 S839P probably benign Het
Psmg1 A G 16: 95,988,097 F87L probably damaging Het
Ptprt A G 2: 161,534,587 M1298T probably benign Het
Skint5 T G 4: 113,539,355 D1207A unknown Het
Stx17 T A 4: 48,183,478 probably null Het
Tas2r114 A T 6: 131,689,136 *310R probably null Het
Tmem130 T A 5: 144,752,414 N139I probably damaging Het
Trpc1 T C 9: 95,726,437 E267G probably damaging Het
Trrap T A 5: 144,857,002 M3398K probably damaging Het
Vrtn T G 12: 84,650,316 D613E probably benign Het
Vsx1 G T 2: 150,688,521 T147K probably benign Het
Wdr55 T C 18: 36,762,178 V103A probably benign Het
Zfp712 A T 13: 67,052,336 D28E probably benign Het
Other mutations in Rbm27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Rbm27 APN 18 42319814 missense possibly damaging 0.82
IGL01630:Rbm27 APN 18 42301840 missense probably damaging 1.00
IGL02045:Rbm27 APN 18 42319913 missense possibly damaging 0.52
IGL03031:Rbm27 APN 18 42333399 critical splice donor site probably null
IGL03085:Rbm27 APN 18 42327524 splice site probably benign
IGL03249:Rbm27 APN 18 42301747 missense probably damaging 0.99
IGL03372:Rbm27 APN 18 42305716 missense probably damaging 0.99
messenger UTSW 18 42333403 splice site probably null
R0048:Rbm27 UTSW 18 42298464 missense probably benign 0.02
R0048:Rbm27 UTSW 18 42298464 missense probably benign 0.02
R0111:Rbm27 UTSW 18 42305672 splice site probably benign
R0122:Rbm27 UTSW 18 42313968 intron probably benign
R0707:Rbm27 UTSW 18 42326026 critical splice donor site probably null
R1253:Rbm27 UTSW 18 42301774 missense probably damaging 0.99
R1268:Rbm27 UTSW 18 42333302 missense probably damaging 1.00
R1317:Rbm27 UTSW 18 42324051 splice site probably benign
R1403:Rbm27 UTSW 18 42317681 missense probably damaging 0.97
R1403:Rbm27 UTSW 18 42317681 missense probably damaging 0.97
R2187:Rbm27 UTSW 18 42325957 missense probably damaging 1.00
R2358:Rbm27 UTSW 18 42292112 splice site probably benign
R3123:Rbm27 UTSW 18 42327165 missense probably damaging 1.00
R3711:Rbm27 UTSW 18 42292112 splice site probably benign
R3712:Rbm27 UTSW 18 42292112 splice site probably benign
R4616:Rbm27 UTSW 18 42301775 missense probably damaging 0.96
R4839:Rbm27 UTSW 18 42327445 missense probably damaging 1.00
R5151:Rbm27 UTSW 18 42338444 missense probably damaging 1.00
R5308:Rbm27 UTSW 18 42327210 missense probably damaging 1.00
R5696:Rbm27 UTSW 18 42317666 missense probably damaging 1.00
R5868:Rbm27 UTSW 18 42300385 missense possibly damaging 0.86
R6058:Rbm27 UTSW 18 42327505 missense probably damaging 1.00
R6477:Rbm27 UTSW 18 42333318 missense probably damaging 1.00
R6658:Rbm27 UTSW 18 42324113 missense probably damaging 1.00
R6700:Rbm27 UTSW 18 42325939 missense probably damaging 1.00
R6784:Rbm27 UTSW 18 42301864 missense probably benign 0.00
R6812:Rbm27 UTSW 18 42333403 splice site probably null
R7162:Rbm27 UTSW 18 42314027 missense unknown
R7606:Rbm27 UTSW 18 42327513 missense probably damaging 1.00
R7904:Rbm27 UTSW 18 42332856 missense probably damaging 1.00
R7987:Rbm27 UTSW 18 42332856 missense probably damaging 1.00
X0065:Rbm27 UTSW 18 42299320 missense possibly damaging 0.70
Z1176:Rbm27 UTSW 18 42333234 frame shift probably null
Z1177:Rbm27 UTSW 18 42338452 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAGTCACTTTGCTCAGTAGTG -3'
(R):5'- GCTAACCTACTAAAAGGAAAGTGAC -3'

Sequencing Primer
(F):5'- GACCAAATATAGGCGTGTCTTAGCTG -3'
(R):5'- AAGGAAAGTGACACTATTCTATATGC -3'
Posted On2018-06-06