Incidental Mutation 'R6500:Pdx1'
ID519667
Institutional Source Beutler Lab
Gene Symbol Pdx1
Ensembl Gene ENSMUSG00000029644
Gene Namepancreatic and duodenal homeobox 1
SynonymsIDX-1, Ipf1, IPF-1, Mody4, pdx-1, STF-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6500 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location147269959-147275848 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 147270630 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 131 (W131L)
Ref Sequence ENSEMBL: ENSMUSP00000082729 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085591]
Predicted Effect probably damaging
Transcript: ENSMUST00000085591
AA Change: W131L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082729
Gene: ENSMUSG00000029644
AA Change: W131L

DomainStartEndE-ValueType
low complexity region 78 109 N/A INTRINSIC
HOX 147 209 4.67e-27 SMART
low complexity region 211 225 N/A INTRINSIC
low complexity region 236 257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201192
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional activator of several genes, including insulin, somatostatin, glucokinase, islet amyloid polypeptide, and glucose transporter type 2. The encoded nuclear protein is involved in the early development of the pancreas and plays a major role in glucose-dependent regulation of insulin gene expression. Defects in this gene are a cause of pancreatic agenesis, which can lead to early-onset insulin-dependent diabetes mellitus (NIDDM), as well as maturity onset diabetes of the young type 4 (MODY4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, abnormal pancreatic and liver development, and increased plasma glucose levels. Mice heterozygous for a knock-out allele exhibit abnormal pancreatic development and abnormal glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,559,606 F461L probably benign Het
Adamtsl3 C A 7: 82,578,610 H1334Q probably benign Het
Adgrf1 A G 17: 43,310,372 N500S probably damaging Het
Afdn A G 17: 13,822,372 D335G possibly damaging Het
Arhgap19 G A 19: 41,786,638 T178M probably damaging Het
Chac2 T C 11: 30,977,625 D86G probably damaging Het
Clhc1 T C 11: 29,560,542 S209P possibly damaging Het
Col1a2 G A 6: 4,515,517 G127S unknown Het
Coro2b A G 9: 62,489,324 F51L probably benign Het
Cux2 A G 5: 121,864,726 S1139P probably benign Het
Cyth3 A T 5: 143,707,840 I379F probably damaging Het
Dock2 A T 11: 34,362,822 L240H possibly damaging Het
Ercc6 A G 14: 32,526,823 K444E probably damaging Het
Fam3b A G 16: 97,500,901 L52P possibly damaging Het
Fat4 T G 3: 38,981,269 Y3023* probably null Het
Gad1 A T 2: 70,593,436 N396Y probably damaging Het
Gbp2b A G 3: 142,611,491 E536G probably benign Het
Gm11564 G A 11: 99,815,235 T123I unknown Het
Herc2 G T 7: 56,146,645 E1922* probably null Het
Hrh4 G T 18: 13,022,468 V355F probably damaging Het
Isyna1 A G 8: 70,594,689 I21V probably damaging Het
Jak1 T C 4: 101,181,933 D165G probably benign Het
Klhl38 C A 15: 58,322,413 G307* probably null Het
Krt77 T C 15: 101,864,337 N269S probably damaging Het
Lrp4 T A 2: 91,492,420 I1118N possibly damaging Het
Ly6i T C 15: 74,981,984 Y30C probably damaging Het
Magi2 A G 5: 20,602,347 E620G possibly damaging Het
Mbl2 A G 19: 30,239,439 D217G possibly damaging Het
Mogat2 T A 7: 99,222,346 I253F probably benign Het
Mpp6 A G 6: 50,198,166 K500E possibly damaging Het
Mpped2 T C 2: 106,861,580 L210P probably damaging Het
Nav3 C A 10: 109,764,756 A1337S probably damaging Het
Ncaph2 T A 15: 89,364,204 V206E probably benign Het
Nlgn1 T C 3: 25,433,930 E747G possibly damaging Het
Nlrc3 C T 16: 3,952,444 G237D possibly damaging Het
Nsun7 A G 5: 66,295,484 D514G probably benign Het
Olfr121 C G 17: 37,752,686 D277E probably damaging Het
Pcnx2 C A 8: 125,753,485 V2028F probably damaging Het
Pkdrej C T 15: 85,819,546 V730I probably damaging Het
Plcg1 T A 2: 160,754,567 Y669N probably damaging Het
Plpp1 G T 13: 112,866,920 W226L probably damaging Het
Sfxn1 G A 13: 54,088,899 V59I probably benign Het
Shank1 T C 7: 44,327,221 I581T unknown Het
Slc35f6 A C 5: 30,656,820 K150N possibly damaging Het
Slc5a7 A T 17: 54,284,203 S234T probably benign Het
Smg6 C T 11: 74,930,505 T534I possibly damaging Het
Ush2a C T 1: 188,841,527 T3649I probably benign Het
Vmn1r158 T C 7: 22,790,653 T44A possibly damaging Het
Vmn1r217 A T 13: 23,113,903 Y276* probably null Het
Vmn2r100 T A 17: 19,522,093 I243N probably damaging Het
Vwde T C 6: 13,208,405 probably null Het
Washc4 C A 10: 83,558,823 P306T probably damaging Het
Wdhd1 C T 14: 47,250,760 probably null Het
Xpo6 T C 7: 126,171,090 probably benign Het
Other mutations in Pdx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01724:Pdx1 APN 5 147274407 missense probably damaging 0.99
IGL02729:Pdx1 APN 5 147274614 missense probably benign 0.21
R6722:Pdx1 UTSW 5 147270500 missense probably damaging 1.00
R6811:Pdx1 UTSW 5 147274664 missense possibly damaging 0.83
R8253:Pdx1 UTSW 5 147270649 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CATCTCCCCATACGAAGTGC -3'
(R):5'- TTGAATGGAGAACAAGCTGCC -3'

Sequencing Primer
(F):5'- ATACGAAGTGCCCCCGCTC -3'
(R):5'- CTGCCAACATGAGTGGACTTACTG -3'
Posted On2018-06-06