Incidental Mutation 'R6500:Vmn1r158'
ID 519671
Institutional Source Beutler Lab
Gene Symbol Vmn1r158
Ensembl Gene ENSMUSG00000094700
Gene Name vomeronasal 1 receptor 158
Synonyms Gm16455
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.594) question?
Stock # R6500 (G1)
Quality Score 185.009
Status Validated
Chromosome 7
Chromosomal Location 22789859-22790782 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22790653 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 44 (T44A)
Ref Sequence ENSEMBL: ENSMUSP00000133990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174643]
AlphaFold G3UY92
Predicted Effect possibly damaging
Transcript: ENSMUST00000174643
AA Change: T44A

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133990
Gene: ENSMUSG00000094700
AA Change: T44A

DomainStartEndE-ValueType
Pfam:TAS2R 8 298 2.9e-15 PFAM
Pfam:7tm_1 39 290 5.5e-9 PFAM
Pfam:V1R 41 298 3.2e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,559,606 F461L probably benign Het
Adamtsl3 C A 7: 82,578,610 H1334Q probably benign Het
Adgrf1 A G 17: 43,310,372 N500S probably damaging Het
Afdn A G 17: 13,822,372 D335G possibly damaging Het
Arhgap19 G A 19: 41,786,638 T178M probably damaging Het
Chac2 T C 11: 30,977,625 D86G probably damaging Het
Clhc1 T C 11: 29,560,542 S209P possibly damaging Het
Col1a2 G A 6: 4,515,517 G127S unknown Het
Coro2b A G 9: 62,489,324 F51L probably benign Het
Cux2 A G 5: 121,864,726 S1139P probably benign Het
Cyth3 A T 5: 143,707,840 I379F probably damaging Het
Dock2 A T 11: 34,362,822 L240H possibly damaging Het
Ercc6 A G 14: 32,526,823 K444E probably damaging Het
Fam3b A G 16: 97,500,901 L52P possibly damaging Het
Fat4 T G 3: 38,981,269 Y3023* probably null Het
Gad1 A T 2: 70,593,436 N396Y probably damaging Het
Gbp2b A G 3: 142,611,491 E536G probably benign Het
Gm11564 G A 11: 99,815,235 T123I unknown Het
Herc2 G T 7: 56,146,645 E1922* probably null Het
Hrh4 G T 18: 13,022,468 V355F probably damaging Het
Isyna1 A G 8: 70,594,689 I21V probably damaging Het
Jak1 T C 4: 101,181,933 D165G probably benign Het
Klhl38 C A 15: 58,322,413 G307* probably null Het
Krt77 T C 15: 101,864,337 N269S probably damaging Het
Lrp4 T A 2: 91,492,420 I1118N possibly damaging Het
Ly6i T C 15: 74,981,984 Y30C probably damaging Het
Magi2 A G 5: 20,602,347 E620G possibly damaging Het
Mbl2 A G 19: 30,239,439 D217G possibly damaging Het
Mogat2 T A 7: 99,222,346 I253F probably benign Het
Mpp6 A G 6: 50,198,166 K500E possibly damaging Het
Mpped2 T C 2: 106,861,580 L210P probably damaging Het
Nav3 C A 10: 109,764,756 A1337S probably damaging Het
Ncaph2 T A 15: 89,364,204 V206E probably benign Het
Nlgn1 T C 3: 25,433,930 E747G possibly damaging Het
Nlrc3 C T 16: 3,952,444 G237D possibly damaging Het
Nsun7 A G 5: 66,295,484 D514G probably benign Het
Olfr121 C G 17: 37,752,686 D277E probably damaging Het
Pcnx2 C A 8: 125,753,485 V2028F probably damaging Het
Pdx1 G T 5: 147,270,630 W131L probably damaging Het
Pkdrej C T 15: 85,819,546 V730I probably damaging Het
Plcg1 T A 2: 160,754,567 Y669N probably damaging Het
Plpp1 G T 13: 112,866,920 W226L probably damaging Het
Sfxn1 G A 13: 54,088,899 V59I probably benign Het
Shank1 T C 7: 44,327,221 I581T unknown Het
Slc35f6 A C 5: 30,656,820 K150N possibly damaging Het
Slc5a7 A T 17: 54,284,203 S234T probably benign Het
Smg6 C T 11: 74,930,505 T534I possibly damaging Het
Ush2a C T 1: 188,841,527 T3649I probably benign Het
Vmn1r217 A T 13: 23,113,903 Y276* probably null Het
Vmn2r100 T A 17: 19,522,093 I243N probably damaging Het
Vwde T C 6: 13,208,405 probably null Het
Washc4 C A 10: 83,558,823 P306T probably damaging Het
Wdhd1 C T 14: 47,250,760 probably null Het
Xpo6 T C 7: 126,171,090 probably benign Het
Other mutations in Vmn1r158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Vmn1r158 APN 7 22790779 missense probably benign 0.01
R1173:Vmn1r158 UTSW 7 22790445 missense probably benign 0.19
R1574:Vmn1r158 UTSW 7 22790347 missense probably damaging 1.00
R1574:Vmn1r158 UTSW 7 22790347 missense probably damaging 1.00
R1725:Vmn1r158 UTSW 7 22790647 missense probably benign 0.08
R1777:Vmn1r158 UTSW 7 22790430 missense probably damaging 1.00
R1813:Vmn1r158 UTSW 7 22790718 missense probably damaging 1.00
R1896:Vmn1r158 UTSW 7 22790718 missense probably damaging 1.00
R2077:Vmn1r158 UTSW 7 22790390 missense probably benign 0.03
R3749:Vmn1r158 UTSW 7 22790214 missense probably damaging 1.00
R4872:Vmn1r158 UTSW 7 22790754 missense possibly damaging 0.94
R5238:Vmn1r158 UTSW 7 22790374 missense probably benign
R6511:Vmn1r158 UTSW 7 22790691 missense probably benign 0.00
R6581:Vmn1r158 UTSW 7 22790040 missense possibly damaging 0.69
R6751:Vmn1r158 UTSW 7 22789881 missense probably damaging 0.96
R7168:Vmn1r158 UTSW 7 22790676 missense possibly damaging 0.82
R7337:Vmn1r158 UTSW 7 22790224 missense probably benign 0.00
R7747:Vmn1r158 UTSW 7 22790300 missense probably benign 0.15
R7902:Vmn1r158 UTSW 7 22790008 missense possibly damaging 0.67
R8328:Vmn1r158 UTSW 7 22790062 missense probably damaging 1.00
R8400:Vmn1r158 UTSW 7 22789880 nonsense probably null
R8809:Vmn1r158 UTSW 7 22790350 missense probably damaging 0.97
R9227:Vmn1r158 UTSW 7 22790044 missense probably benign 0.02
R9468:Vmn1r158 UTSW 7 22790463 missense probably damaging 1.00
Z1177:Vmn1r158 UTSW 7 22790458 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CTGATGGAAACTCAGGACACAG -3'
(R):5'- CCCACAGAGAGTAGTGTCCTATC -3'

Sequencing Primer
(F):5'- AAGTTTGTGCTTCTTGCCACCAG -3'
(R):5'- CACAGAGAGTAGTGTCCTATCTATTC -3'
Posted On 2018-06-06