Incidental Mutation 'R6500:Washc4'
ID519680
Institutional Source Beutler Lab
Gene Symbol Washc4
Ensembl Gene ENSMUSG00000034560
Gene NameWASH complex subunit 4
SynonymsA230046K03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R6500 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location83543752-83596473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 83558823 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 306 (P306T)
Ref Sequence ENSEMBL: ENSMUSP00000039322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038388] [ENSMUST00000217842]
Predicted Effect probably damaging
Transcript: ENSMUST00000038388
AA Change: P306T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039322
Gene: ENSMUSG00000034560
AA Change: P306T

DomainStartEndE-ValueType
Pfam:WASH-7_N 32 604 4.8e-245 PFAM
Pfam:WASH-7_mid 605 949 7.9e-176 PFAM
low complexity region 954 965 N/A INTRINSIC
Pfam:WASH-7_C 966 1135 9.1e-76 PFAM
low complexity region 1138 1156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217842
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the WASH complex, which functions in the intracellular transport of endosomes. Mutations in this gene have been detected in individuals with autosomal recessive mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,559,606 F461L probably benign Het
Adamtsl3 C A 7: 82,578,610 H1334Q probably benign Het
Adgrf1 A G 17: 43,310,372 N500S probably damaging Het
Afdn A G 17: 13,822,372 D335G possibly damaging Het
Arhgap19 G A 19: 41,786,638 T178M probably damaging Het
Chac2 T C 11: 30,977,625 D86G probably damaging Het
Clhc1 T C 11: 29,560,542 S209P possibly damaging Het
Col1a2 G A 6: 4,515,517 G127S unknown Het
Coro2b A G 9: 62,489,324 F51L probably benign Het
Cux2 A G 5: 121,864,726 S1139P probably benign Het
Cyth3 A T 5: 143,707,840 I379F probably damaging Het
Dock2 A T 11: 34,362,822 L240H possibly damaging Het
Ercc6 A G 14: 32,526,823 K444E probably damaging Het
Fam3b A G 16: 97,500,901 L52P possibly damaging Het
Fat4 T G 3: 38,981,269 Y3023* probably null Het
Gad1 A T 2: 70,593,436 N396Y probably damaging Het
Gbp2b A G 3: 142,611,491 E536G probably benign Het
Gm11564 G A 11: 99,815,235 T123I unknown Het
Herc2 G T 7: 56,146,645 E1922* probably null Het
Hrh4 G T 18: 13,022,468 V355F probably damaging Het
Isyna1 A G 8: 70,594,689 I21V probably damaging Het
Jak1 T C 4: 101,181,933 D165G probably benign Het
Klhl38 C A 15: 58,322,413 G307* probably null Het
Krt77 T C 15: 101,864,337 N269S probably damaging Het
Lrp4 T A 2: 91,492,420 I1118N possibly damaging Het
Ly6i T C 15: 74,981,984 Y30C probably damaging Het
Magi2 A G 5: 20,602,347 E620G possibly damaging Het
Mbl2 A G 19: 30,239,439 D217G possibly damaging Het
Mogat2 T A 7: 99,222,346 I253F probably benign Het
Mpp6 A G 6: 50,198,166 K500E possibly damaging Het
Mpped2 T C 2: 106,861,580 L210P probably damaging Het
Nav3 C A 10: 109,764,756 A1337S probably damaging Het
Ncaph2 T A 15: 89,364,204 V206E probably benign Het
Nlgn1 T C 3: 25,433,930 E747G possibly damaging Het
Nlrc3 C T 16: 3,952,444 G237D possibly damaging Het
Nsun7 A G 5: 66,295,484 D514G probably benign Het
Olfr121 C G 17: 37,752,686 D277E probably damaging Het
Pcnx2 C A 8: 125,753,485 V2028F probably damaging Het
Pdx1 G T 5: 147,270,630 W131L probably damaging Het
Pkdrej C T 15: 85,819,546 V730I probably damaging Het
Plcg1 T A 2: 160,754,567 Y669N probably damaging Het
Plpp1 G T 13: 112,866,920 W226L probably damaging Het
Sfxn1 G A 13: 54,088,899 V59I probably benign Het
Shank1 T C 7: 44,327,221 I581T unknown Het
Slc35f6 A C 5: 30,656,820 K150N possibly damaging Het
Slc5a7 A T 17: 54,284,203 S234T probably benign Het
Smg6 C T 11: 74,930,505 T534I possibly damaging Het
Ush2a C T 1: 188,841,527 T3649I probably benign Het
Vmn1r158 T C 7: 22,790,653 T44A possibly damaging Het
Vmn1r217 A T 13: 23,113,903 Y276* probably null Het
Vmn2r100 T A 17: 19,522,093 I243N probably damaging Het
Vwde T C 6: 13,208,405 probably null Het
Wdhd1 C T 14: 47,250,760 probably null Het
Xpo6 T C 7: 126,171,090 probably benign Het
Other mutations in Washc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Washc4 APN 10 83550883 missense probably benign 0.07
IGL01370:Washc4 APN 10 83558830 missense probably damaging 0.98
IGL01524:Washc4 APN 10 83576132 missense probably benign 0.37
IGL01682:Washc4 APN 10 83580306 missense possibly damaging 0.93
IGL01973:Washc4 APN 10 83556109 missense probably damaging 0.99
IGL02002:Washc4 APN 10 83579543 missense possibly damaging 0.95
IGL02020:Washc4 APN 10 83564472 missense probably damaging 0.97
IGL02230:Washc4 APN 10 83581369 missense probably benign 0.00
IGL02421:Washc4 APN 10 83579550 missense probably damaging 0.98
IGL02514:Washc4 APN 10 83570083 missense probably damaging 0.98
IGL02619:Washc4 APN 10 83558853 missense possibly damaging 0.84
IGL02852:Washc4 APN 10 83583309 missense possibly damaging 0.95
IGL02870:Washc4 APN 10 83585876 missense probably benign
IGL03181:Washc4 APN 10 83591019 missense probably damaging 1.00
IGL03247:Washc4 APN 10 83564463 missense probably benign 0.02
R0458:Washc4 UTSW 10 83546799 missense possibly damaging 0.70
R0462:Washc4 UTSW 10 83556913 missense probably benign 0.00
R0471:Washc4 UTSW 10 83558734 splice site probably benign
R1144:Washc4 UTSW 10 83580330 missense probably damaging 0.97
R1560:Washc4 UTSW 10 83556109 missense probably damaging 0.99
R1789:Washc4 UTSW 10 83579525 missense possibly damaging 0.92
R1819:Washc4 UTSW 10 83550884 missense probably benign 0.08
R2421:Washc4 UTSW 10 83579521 missense probably damaging 0.97
R2882:Washc4 UTSW 10 83579501 missense possibly damaging 0.93
R2902:Washc4 UTSW 10 83554763 nonsense probably null
R3436:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3437:Washc4 UTSW 10 83570002 missense probably benign 0.33
R3552:Washc4 UTSW 10 83546856 missense probably benign 0.45
R4646:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4647:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4648:Washc4 UTSW 10 83574543 missense possibly damaging 0.71
R4732:Washc4 UTSW 10 83574479 missense probably benign
R4733:Washc4 UTSW 10 83574479 missense probably benign
R4750:Washc4 UTSW 10 83591052 missense probably damaging 0.99
R4835:Washc4 UTSW 10 83579512 missense possibly damaging 0.93
R5024:Washc4 UTSW 10 83583336 missense possibly damaging 0.71
R5055:Washc4 UTSW 10 83556907 missense probably damaging 0.99
R5414:Washc4 UTSW 10 83556103 missense possibly damaging 0.95
R5423:Washc4 UTSW 10 83579554 missense possibly damaging 0.71
R5428:Washc4 UTSW 10 83574522 missense probably benign 0.00
R5506:Washc4 UTSW 10 83581337 missense probably damaging 0.97
R5540:Washc4 UTSW 10 83573793 missense probably damaging 0.99
R5667:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5671:Washc4 UTSW 10 83570028 missense probably damaging 0.97
R5777:Washc4 UTSW 10 83555605 missense probably damaging 1.00
R6369:Washc4 UTSW 10 83574444 missense probably damaging 1.00
R6370:Washc4 UTSW 10 83571362 missense possibly damaging 0.85
R6645:Washc4 UTSW 10 83572195 nonsense probably null
R6657:Washc4 UTSW 10 83558618 missense possibly damaging 0.92
R6829:Washc4 UTSW 10 83560516 missense probably damaging 0.97
R6862:Washc4 UTSW 10 83558893 missense possibly damaging 0.92
R6899:Washc4 UTSW 10 83576055 missense probably benign 0.07
R7144:Washc4 UTSW 10 83573774 critical splice acceptor site probably null
R7163:Washc4 UTSW 10 83591033 missense probably damaging 0.99
R7477:Washc4 UTSW 10 83574443 missense probably damaging 0.99
R7900:Washc4 UTSW 10 83573773 splice site probably null
R8491:Washc4 UTSW 10 83576123 missense probably benign 0.24
R8791:Washc4 UTSW 10 83550884 missense probably benign 0.08
R8804:Washc4 UTSW 10 83572151 missense probably damaging 0.99
X0017:Washc4 UTSW 10 83591143 missense probably damaging 1.00
X0066:Washc4 UTSW 10 83558829 frame shift probably null
Z1088:Washc4 UTSW 10 83576741 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCCTGTGTAGGCCTGTATCG -3'
(R):5'- CGCACGGCATTACCTAAGTC -3'

Sequencing Primer
(F):5'- CCTGTGTAGGCCTGTATCGAACAG -3'
(R):5'- ACGGCATTACCTAAGTCCTGGAG -3'
Posted On2018-06-06