Incidental Mutation 'R6500:Ly6i'
ID519694
Institutional Source Beutler Lab
Gene Symbol Ly6i
Ensembl Gene ENSMUSG00000022586
Gene Namelymphocyte antigen 6 complex, locus I
SynonymsLy-6M, Ly-6I
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6500 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location74979534-74983430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74981984 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 30 (Y30C)
Ref Sequence ENSEMBL: ENSMUSP00000129867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023250] [ENSMUST00000166694]
Predicted Effect probably damaging
Transcript: ENSMUST00000023250
AA Change: Y30C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023250
Gene: ENSMUSG00000022586
AA Change: Y30C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 1.04e-26 SMART
low complexity region 119 130 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166694
AA Change: Y30C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129867
Gene: ENSMUSG00000022586
AA Change: Y30C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LU 27 118 1.04e-26 SMART
low complexity region 119 130 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188378
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A G 12: 81,559,606 F461L probably benign Het
Adamtsl3 C A 7: 82,578,610 H1334Q probably benign Het
Adgrf1 A G 17: 43,310,372 N500S probably damaging Het
Afdn A G 17: 13,822,372 D335G possibly damaging Het
Arhgap19 G A 19: 41,786,638 T178M probably damaging Het
Chac2 T C 11: 30,977,625 D86G probably damaging Het
Clhc1 T C 11: 29,560,542 S209P possibly damaging Het
Col1a2 G A 6: 4,515,517 G127S unknown Het
Coro2b A G 9: 62,489,324 F51L probably benign Het
Cux2 A G 5: 121,864,726 S1139P probably benign Het
Cyth3 A T 5: 143,707,840 I379F probably damaging Het
Dock2 A T 11: 34,362,822 L240H possibly damaging Het
Ercc6 A G 14: 32,526,823 K444E probably damaging Het
Fam3b A G 16: 97,500,901 L52P possibly damaging Het
Fat4 T G 3: 38,981,269 Y3023* probably null Het
Gad1 A T 2: 70,593,436 N396Y probably damaging Het
Gbp2b A G 3: 142,611,491 E536G probably benign Het
Gm11564 G A 11: 99,815,235 T123I unknown Het
Herc2 G T 7: 56,146,645 E1922* probably null Het
Hrh4 G T 18: 13,022,468 V355F probably damaging Het
Isyna1 A G 8: 70,594,689 I21V probably damaging Het
Jak1 T C 4: 101,181,933 D165G probably benign Het
Klhl38 C A 15: 58,322,413 G307* probably null Het
Krt77 T C 15: 101,864,337 N269S probably damaging Het
Lrp4 T A 2: 91,492,420 I1118N possibly damaging Het
Magi2 A G 5: 20,602,347 E620G possibly damaging Het
Mbl2 A G 19: 30,239,439 D217G possibly damaging Het
Mogat2 T A 7: 99,222,346 I253F probably benign Het
Mpp6 A G 6: 50,198,166 K500E possibly damaging Het
Mpped2 T C 2: 106,861,580 L210P probably damaging Het
Nav3 C A 10: 109,764,756 A1337S probably damaging Het
Ncaph2 T A 15: 89,364,204 V206E probably benign Het
Nlgn1 T C 3: 25,433,930 E747G possibly damaging Het
Nlrc3 C T 16: 3,952,444 G237D possibly damaging Het
Nsun7 A G 5: 66,295,484 D514G probably benign Het
Olfr121 C G 17: 37,752,686 D277E probably damaging Het
Pcnx2 C A 8: 125,753,485 V2028F probably damaging Het
Pdx1 G T 5: 147,270,630 W131L probably damaging Het
Pkdrej C T 15: 85,819,546 V730I probably damaging Het
Plcg1 T A 2: 160,754,567 Y669N probably damaging Het
Plpp1 G T 13: 112,866,920 W226L probably damaging Het
Sfxn1 G A 13: 54,088,899 V59I probably benign Het
Shank1 T C 7: 44,327,221 I581T unknown Het
Slc35f6 A C 5: 30,656,820 K150N possibly damaging Het
Slc5a7 A T 17: 54,284,203 S234T probably benign Het
Smg6 C T 11: 74,930,505 T534I possibly damaging Het
Ush2a C T 1: 188,841,527 T3649I probably benign Het
Vmn1r158 T C 7: 22,790,653 T44A possibly damaging Het
Vmn1r217 A T 13: 23,113,903 Y276* probably null Het
Vmn2r100 T A 17: 19,522,093 I243N probably damaging Het
Vwde T C 6: 13,208,405 probably null Het
Washc4 C A 10: 83,558,823 P306T probably damaging Het
Wdhd1 C T 14: 47,250,760 probably null Het
Xpo6 T C 7: 126,171,090 probably benign Het
Other mutations in Ly6i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Ly6i APN 15 74980032 missense possibly damaging 0.88
IGL02193:Ly6i APN 15 74983030 nonsense probably null
R1454:Ly6i UTSW 15 74983055 missense possibly damaging 0.91
R4223:Ly6i UTSW 15 74983035 missense probably benign 0.45
R6185:Ly6i UTSW 15 74980030 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTCTATTTGGAGGGAGGGCAAC -3'
(R):5'- TCAAACAATGGTGGCTCTTGG -3'

Sequencing Primer
(F):5'- GGCAACCATGATCAATAACAAATAC -3'
(R):5'- AAACAATGGTGGCTCTTGGTTCAC -3'
Posted On2018-06-06