Incidental Mutation 'R6501:Plekha5'
ID519724
Institutional Source Beutler Lab
Gene Symbol Plekha5
Ensembl Gene ENSMUSG00000030231
Gene Namepleckstrin homology domain containing, family A member 5
SynonymsPEPP2, Tg(AMH-cre)1Flor, Gt(Ayu21)9Imeg, AMH-Cre, 2810431N21Rik, Ayu21-9
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R6501 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location140424054-140597110 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 140525929 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 26 (Y26*)
Ref Sequence ENSEMBL: ENSMUSP00000145336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087622] [ENSMUST00000203517] [ENSMUST00000203774] [ENSMUST00000204145] [ENSMUST00000204876]
Predicted Effect probably null
Transcript: ENSMUST00000087622
AA Change: Y135*
SMART Domains Protein: ENSMUSP00000084904
Gene: ENSMUSG00000030231
AA Change: Y135*

DomainStartEndE-ValueType
WW 12 44 1.51e-3 SMART
WW 58 90 2.17e-4 SMART
PH 171 271 1.85e-17 SMART
Blast:PH 592 715 7e-39 BLAST
coiled coil region 747 781 N/A INTRINSIC
low complexity region 896 916 N/A INTRINSIC
low complexity region 924 938 N/A INTRINSIC
low complexity region 1206 1224 N/A INTRINSIC
low complexity region 1243 1258 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203517
AA Change: Y135*
SMART Domains Protein: ENSMUSP00000145478
Gene: ENSMUSG00000030231
AA Change: Y135*

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
PH 171 271 8.6e-20 SMART
Blast:PH 586 697 3e-15 BLAST
coiled coil region 702 736 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203774
AA Change: Y26*
SMART Domains Protein: ENSMUSP00000144832
Gene: ENSMUSG00000030231
AA Change: Y26*

DomainStartEndE-ValueType
PH 62 162 8.6e-20 SMART
Blast:PH 477 511 4e-8 BLAST
low complexity region 512 521 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000203955
AA Change: Y58*
Predicted Effect probably null
Transcript: ENSMUST00000204145
AA Change: Y135*
SMART Domains Protein: ENSMUSP00000145457
Gene: ENSMUSG00000030231
AA Change: Y135*

DomainStartEndE-ValueType
WW 12 44 9e-6 SMART
WW 58 90 1.3e-6 SMART
Blast:PH 114 151 6e-14 BLAST
PDB:2DKP|A 163 196 1e-5 PDB
Predicted Effect probably null
Transcript: ENSMUST00000204876
AA Change: Y26*
SMART Domains Protein: ENSMUSP00000145336
Gene: ENSMUSG00000030231
AA Change: Y26*

DomainStartEndE-ValueType
PH 62 162 8.6e-20 SMART
Blast:PH 483 517 3e-8 BLAST
low complexity region 518 527 N/A INTRINSIC
Meta Mutation Damage Score 0.656 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,461,521 C154* probably null Het
Ada A G 2: 163,728,188 probably null Het
Birc6 G A 17: 74,579,281 V535I probably damaging Het
Bptf T C 11: 107,077,683 N1058S probably null Het
Cdadc1 C T 14: 59,586,449 C198Y probably benign Het
Chrna7 G A 7: 63,106,115 R228C probably damaging Het
Cts6 T C 13: 61,196,335 N301S probably damaging Het
Cts8 T A 13: 61,250,942 D250V probably damaging Het
Cyp26a1 G T 19: 37,699,070 R235L possibly damaging Het
Disc1 A T 8: 125,218,105 M598L probably benign Het
Ear6 T A 14: 51,854,224 V76D possibly damaging Het
Grifin A G 5: 140,563,281 *145R probably null Het
Htr2b T G 1: 86,110,641 E11A probably damaging Het
Krtap4-9 T A 11: 99,785,429 probably benign Het
Larp4b A C 13: 9,168,793 H522P probably damaging Het
Macf1 A T 4: 123,469,632 probably null Het
Mdfic T C 6: 15,770,517 L174P possibly damaging Het
Mmp17 A G 5: 129,606,405 E535G probably benign Het
Nfxl1 A T 5: 72,528,509 probably null Het
Nynrin A T 14: 55,863,532 T260S probably benign Het
Olfr1294 C T 2: 111,537,779 G170D probably damaging Het
Olfr859 A T 9: 19,808,975 Y219F possibly damaging Het
Olfr905 A T 9: 38,473,289 I181F possibly damaging Het
Pbx1 G T 1: 168,209,534 D109E probably damaging Het
Pde4d A T 13: 109,116,942 H101L probably benign Het
Pdlim3 T C 8: 45,908,602 I155T possibly damaging Het
Prpf6 T A 2: 181,621,920 L191* probably null Het
Rabl6 A G 2: 25,602,447 V80A possibly damaging Het
Rp1 T C 1: 4,311,280 probably benign Het
Sec14l1 A G 11: 117,156,850 S698G probably damaging Het
Skiv2l A G 17: 34,844,436 S622P possibly damaging Het
Slc19a1 G A 10: 77,049,606 G447S probably benign Het
Slc2a6 A T 2: 27,023,131 Y383* probably null Het
Slc9a9 C A 9: 94,936,371 Q273K probably benign Het
Spint2 A G 7: 29,263,706 Y56H probably damaging Het
Sspo T A 6: 48,495,212 M123K possibly damaging Het
Syne2 A G 12: 76,027,847 probably null Het
Trdn A C 10: 33,466,454 K619N probably benign Het
Ttll13 A G 7: 80,250,176 T119A possibly damaging Het
Ttn T C 2: 76,785,646 Y8324C probably damaging Het
Ttn T C 2: 76,898,258 probably benign Het
Vav2 A G 2: 27,296,219 L208P probably damaging Het
Vmn1r179 A G 7: 23,928,917 I178V probably benign Het
Vmn1r210 T C 13: 22,827,535 M194V possibly damaging Het
Vmn2r103 A T 17: 19,811,904 T647S probably benign Het
Wdr49 T A 3: 75,339,458 H289L probably benign Het
Wnk2 T G 13: 49,146,683 K184Q probably damaging Het
Zfp758 A G 17: 22,371,997 probably benign Het
Other mutations in Plekha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Plekha5 APN 6 140570096 splice site probably benign
IGL00908:Plekha5 APN 6 140550930 missense probably damaging 1.00
IGL01346:Plekha5 APN 6 140534566 splice site probably benign
IGL01380:Plekha5 APN 6 140570316 splice site probably benign
IGL01406:Plekha5 APN 6 140572950 missense probably damaging 0.99
IGL01408:Plekha5 APN 6 140570316 splice site probably benign
IGL01688:Plekha5 APN 6 140569389 missense probably damaging 0.98
IGL01719:Plekha5 APN 6 140570129 missense probably damaging 1.00
IGL01926:Plekha5 APN 6 140525916 missense probably benign 0.12
IGL01936:Plekha5 APN 6 140524895 missense probably damaging 1.00
IGL02326:Plekha5 APN 6 140583850 nonsense probably null
IGL02544:Plekha5 APN 6 140589728 missense possibly damaging 0.78
IGL02573:Plekha5 APN 6 140582016 missense probably damaging 1.00
IGL02704:Plekha5 APN 6 140543866 missense probably damaging 1.00
IGL02959:Plekha5 APN 6 140544178 missense probably damaging 1.00
Doubletime UTSW 6 140525929 nonsense probably null
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0067:Plekha5 UTSW 6 140524903 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0095:Plekha5 UTSW 6 140528597 missense probably damaging 1.00
R0105:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0107:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0359:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0360:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0362:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0363:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0364:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0365:Plekha5 UTSW 6 140591747 missense possibly damaging 0.80
R0833:Plekha5 UTSW 6 140589634 splice site probably benign
R0835:Plekha5 UTSW 6 140568850 nonsense probably null
R0836:Plekha5 UTSW 6 140589634 splice site probably benign
R0944:Plekha5 UTSW 6 140570196 splice site probably benign
R2015:Plekha5 UTSW 6 140534564 critical splice donor site probably null
R2043:Plekha5 UTSW 6 140552804 splice site probably benign
R2086:Plekha5 UTSW 6 140570318 splice site probably null
R2102:Plekha5 UTSW 6 140572877 missense probably damaging 1.00
R2109:Plekha5 UTSW 6 140424216 missense possibly damaging 0.56
R2135:Plekha5 UTSW 6 140580499 missense possibly damaging 0.66
R2150:Plekha5 UTSW 6 140570403 missense probably damaging 1.00
R2211:Plekha5 UTSW 6 140525861 missense possibly damaging 0.56
R2414:Plekha5 UTSW 6 140550856 missense probably damaging 1.00
R2915:Plekha5 UTSW 6 140589199 missense probably damaging 0.96
R3120:Plekha5 UTSW 6 140591641 missense probably benign 0.00
R3924:Plekha5 UTSW 6 140570379 missense possibly damaging 0.78
R4049:Plekha5 UTSW 6 140583871 missense probably damaging 1.00
R4056:Plekha5 UTSW 6 140589232 missense possibly damaging 0.46
R4077:Plekha5 UTSW 6 140555921 intron probably null
R4320:Plekha5 UTSW 6 140543817 missense possibly damaging 0.68
R4343:Plekha5 UTSW 6 140556054 missense probably damaging 0.99
R4359:Plekha5 UTSW 6 140591688 missense probably benign 0.07
R4377:Plekha5 UTSW 6 140579465 missense probably damaging 1.00
R4480:Plekha5 UTSW 6 140526479 missense probably damaging 1.00
R4533:Plekha5 UTSW 6 140570331 missense probably damaging 1.00
R4623:Plekha5 UTSW 6 140551186 missense probably damaging 0.98
R4672:Plekha5 UTSW 6 140524929 missense probably damaging 0.98
R4871:Plekha5 UTSW 6 140525910 missense probably damaging 1.00
R4903:Plekha5 UTSW 6 140586367 missense probably damaging 1.00
R5121:Plekha5 UTSW 6 140579474 missense probably damaging 1.00
R5156:Plekha5 UTSW 6 140426528 missense probably damaging 1.00
R5376:Plekha5 UTSW 6 140551144 missense probably damaging 1.00
R5445:Plekha5 UTSW 6 140552733 nonsense probably null
R5753:Plekha5 UTSW 6 140537004 critical splice acceptor site probably null
R5836:Plekha5 UTSW 6 140426524 missense probably damaging 1.00
R5972:Plekha5 UTSW 6 140572913 missense possibly damaging 0.78
R6196:Plekha5 UTSW 6 140579453 missense probably benign 0.28
R6254:Plekha5 UTSW 6 140586436 missense probably damaging 1.00
R6620:Plekha5 UTSW 6 140572875 missense probably damaging 1.00
R6663:Plekha5 UTSW 6 140577290 missense probably damaging 1.00
R6823:Plekha5 UTSW 6 140525858 missense probably benign 0.16
R6992:Plekha5 UTSW 6 140543908 missense probably damaging 1.00
R7196:Plekha5 UTSW 6 140543922 missense possibly damaging 0.83
R7487:Plekha5 UTSW 6 140570333 missense probably benign 0.25
R7493:Plekha5 UTSW 6 140580435 missense probably benign 0.02
R7557:Plekha5 UTSW 6 140426545 missense probably damaging 0.96
X0027:Plekha5 UTSW 6 140424423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCTTTATGCCTGAGGAGG -3'
(R):5'- TAGCTGATTCAACAGAATACCCATTCC -3'

Sequencing Primer
(F):5'- GCCTTGGTCTGAAGCAGTTCAC -3'
(R):5'- TCAACAGAATACCCATTCCCTCATAC -3'
Posted On2018-06-06