Mutagenetix > Incidental Mutation

Incidental Mutation 'R6501:Pdlim3'

519729

Institutional Source

Beutler Lab

Gene Symbol

Pdlim3

Ensembl Gene

ENSMUSG00000031636

Gene Name

PDZ and LIM domain 3

Synonyms

ALP

MMRRC Submission

Accession Numbers

Genbank: NM_016798; MGI: 1859274

Essential gene?

Possibly essential (E-score: 0.703) question?

Stock #

R6501 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

45885461-45919548 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 45908602 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 155 (I155T)

Ref Sequence

ENSEMBL: ENSMUSP00000034053 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034053] [ENSMUST00000210422]

AlphaFold

O70209

PDB Structure

Solution structure of PDZ domain of mouse Alpha-actinin-2 associated LIM protein [SOLUTION NMR]
Solution structure of the LIM domain of alpha-actinin-2 associated LIM protein [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034053
AA Change: I155T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000034053
Gene: ENSMUSG00000031636
AA Change: I155T

Domain	Start	End	E-Value	Type
PDZ	11	84	3.86e-16	SMART
ZM	137	162	5.55e-11	SMART
LIM	245	296	3.73e-14	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000210422

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211190

Meta Mutation Damage Score

0.2901

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.1%

Validation Efficiency

100% (48/48)

MGI Phenotype

PHENOTYPE: Homozygotes for a knock-out allele show no major defects in skeletal muscle. However, homozygotes for another knock-out allele show partial background-sensitive prenatal lethality, embryonic right ventricular (RV) dilation and dysplasia, hypotrabeculation, and RV cardiomyopathy in surviving adults. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd8	A	T	8: 71,461,521	C154*	probably null	Het
Ada	A	G	2: 163,728,188		probably null	Het
Birc6	G	A	17: 74,579,281	V535I	probably damaging	Het
Bptf	T	C	11: 107,077,683	N1058S	probably null	Het
Cdadc1	C	T	14: 59,586,449	C198Y	probably benign	Het
Chrna7	G	A	7: 63,106,115	R228C	probably damaging	Het
Cts6	T	C	13: 61,196,335	N301S	probably damaging	Het
Cts8	T	A	13: 61,250,942	D250V	probably damaging	Het
Cyp26a1	G	T	19: 37,699,070	R235L	possibly damaging	Het
Disc1	A	T	8: 125,218,105	M598L	probably benign	Het
Ear6	T	A	14: 51,854,224	V76D	possibly damaging	Het
Grifin	A	G	5: 140,563,281	*145R	probably null	Het
Htr2b	T	G	1: 86,110,641	E11A	probably damaging	Het
Krtap4-9	T	A	11: 99,785,429		probably benign	Het
Larp4b	A	C	13: 9,168,793	H522P	probably damaging	Het
Macf1	A	T	4: 123,469,632		probably null	Het
Mdfic	T	C	6: 15,770,517	L174P	possibly damaging	Het
Mmp17	A	G	5: 129,606,405	E535G	probably benign	Het
Nfxl1	A	T	5: 72,528,509		probably null	Het
Nynrin	A	T	14: 55,863,532	T260S	probably benign	Het
Olfr1294	C	T	2: 111,537,779	G170D	probably damaging	Het
Olfr859	A	T	9: 19,808,975	Y219F	possibly damaging	Het
Olfr905	A	T	9: 38,473,289	I181F	possibly damaging	Het
Pbx1	G	T	1: 168,209,534	D109E	probably damaging	Het
Pde4d	A	T	13: 109,116,942	H101L	probably benign	Het
Plekha5	T	A	6: 140,525,929	Y26*	probably null	Het
Prpf6	T	A	2: 181,621,920	L191*	probably null	Het
Rabl6	A	G	2: 25,602,447	V80A	possibly damaging	Het
Rp1	T	C	1: 4,311,280		probably benign	Het
Sec14l1	A	G	11: 117,156,850	S698G	probably damaging	Het
Skiv2l	A	G	17: 34,844,436	S622P	possibly damaging	Het
Slc19a1	G	A	10: 77,049,606	G447S	probably benign	Het
Slc2a6	A	T	2: 27,023,131	Y383*	probably null	Het
Slc9a9	C	A	9: 94,936,371	Q273K	probably benign	Het
Spint2	A	G	7: 29,263,706	Y56H	probably damaging	Het
Sspo	T	A	6: 48,495,212	M123K	possibly damaging	Het
Syne2	A	G	12: 76,027,847		probably null	Het
Trdn	A	C	10: 33,466,454	K619N	probably benign	Het
Ttll13	A	G	7: 80,250,176	T119A	possibly damaging	Het
Ttn	T	C	2: 76,785,646	Y8324C	probably damaging	Het
Ttn	T	C	2: 76,898,258		probably benign	Het
Vav2	A	G	2: 27,296,219	L208P	probably damaging	Het
Vmn1r179	A	G	7: 23,928,917	I178V	probably benign	Het
Vmn1r210	T	C	13: 22,827,535	M194V	possibly damaging	Het
Vmn2r103	A	T	17: 19,811,904	T647S	probably benign	Het
Wdr49	T	A	3: 75,339,458	H289L	probably benign	Het
Wnk2	T	G	13: 49,146,683	K184Q	probably damaging	Het
Zfp758	A	G	17: 22,371,997		probably benign	Het

Other mutations in Pdlim3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00767:Pdlim3	APN	8	45896790	missense	probably damaging	1.00
IGL01341:Pdlim3	APN	8	45915240	missense	probably benign
IGL02189:Pdlim3	APN	8	45885593	missense	probably damaging	1.00
IGL02834:Pdlim3	APN	8	45917532	missense	probably benign	0.02
IGL03165:Pdlim3	APN	8	45918998	missense	possibly damaging	0.82
C9142:Pdlim3	UTSW	8	45896832	missense	probably benign	0.37
R0244:Pdlim3	UTSW	8	45908460	intron	probably benign
R0369:Pdlim3	UTSW	8	45917506	missense	probably benign
R1052:Pdlim3	UTSW	8	45896800	missense	probably damaging	1.00
R1142:Pdlim3	UTSW	8	45918961	missense	probably damaging	1.00
R1531:Pdlim3	UTSW	8	45896763	missense	probably damaging	1.00
R1607:Pdlim3	UTSW	8	45896859	missense	probably damaging	1.00
R1645:Pdlim3	UTSW	8	45896748	missense	probably benign	0.37
R5641:Pdlim3	UTSW	8	45915263	splice site	probably null
R5731:Pdlim3	UTSW	8	45915247	missense	probably benign
R7111:Pdlim3	UTSW	8	45917502	missense	probably damaging	0.99
R7637:Pdlim3	UTSW	8	45909065	missense	probably damaging	1.00
R7701:Pdlim3	UTSW	8	45908539	missense	probably benign	0.17
R8223:Pdlim3	UTSW	8	45900525	missense	possibly damaging	0.80
R8380:Pdlim3	UTSW	8	45917535	missense	probably benign
R9163:Pdlim3	UTSW	8	45885674	critical splice donor site	probably null
R9673:Pdlim3	UTSW	8	45915158	missense	possibly damaging	0.52
Z1177:Pdlim3	UTSW	8	45909079	missense	possibly damaging	0.63
Z1177:Pdlim3	UTSW	8	45909080	missense	possibly damaging	0.77
Z1177:Pdlim3	UTSW	8	45918984	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TAACAGCTTTATTGTGCGCTCTG -3'
(R):5'- GCTTCGGAGTAACAAGAGTCC -3'

Sequencing Primer
(F):5'- ATTGTGCGCTCTGTGGCTC -3'
(R):5'- CTTCGGAGTAACAAGAGTCCAGTTTG -3'

Posted On

2018-06-06