Incidental Mutation 'R6501:Abhd8'
ID519730
Institutional Source Beutler Lab
Gene Symbol Abhd8
Ensembl Gene ENSMUSG00000007950
Gene Nameabhydrolase domain containing 8
Synonyms0910001L24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6501 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location71456705-71463655 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 71461521 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 154 (C154*)
Ref Sequence ENSEMBL: ENSMUSP00000008094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008094] [ENSMUST00000048914]
Predicted Effect probably null
Transcript: ENSMUST00000008094
AA Change: C154*
SMART Domains Protein: ENSMUSP00000008094
Gene: ENSMUSG00000007950
AA Change: C154*

DomainStartEndE-ValueType
low complexity region 57 72 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 139 148 N/A INTRINSIC
Pfam:Hydrolase_4 164 397 2e-17 PFAM
Pfam:Abhydrolase_1 168 289 1.2e-19 PFAM
Pfam:Abhydrolase_5 168 391 2.4e-20 PFAM
Pfam:Abhydrolase_6 170 403 1.4e-17 PFAM
low complexity region 411 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048914
SMART Domains Protein: ENSMUSP00000044497
Gene: ENSMUSG00000034880

DomainStartEndE-ValueType
Pfam:Ribosomal_L34 49 92 1.6e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212503
Meta Mutation Damage Score 0.608 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is upstream of, and in a head-to-head orientation with the gene for the mitochondrial ribosomal protein L34. The predicted protein contains alpha/beta hydrolase fold and secretory lipase domains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ada A G 2: 163,728,188 probably null Het
Birc6 G A 17: 74,579,281 V535I probably damaging Het
Bptf T C 11: 107,077,683 N1058S probably null Het
Cdadc1 C T 14: 59,586,449 C198Y probably benign Het
Chrna7 G A 7: 63,106,115 R228C probably damaging Het
Cts6 T C 13: 61,196,335 N301S probably damaging Het
Cts8 T A 13: 61,250,942 D250V probably damaging Het
Cyp26a1 G T 19: 37,699,070 R235L possibly damaging Het
Disc1 A T 8: 125,218,105 M598L probably benign Het
Ear6 T A 14: 51,854,224 V76D possibly damaging Het
Grifin A G 5: 140,563,281 *145R probably null Het
Htr2b T G 1: 86,110,641 E11A probably damaging Het
Krtap4-9 T A 11: 99,785,429 probably benign Het
Larp4b A C 13: 9,168,793 H522P probably damaging Het
Macf1 A T 4: 123,469,632 probably null Het
Mdfic T C 6: 15,770,517 L174P possibly damaging Het
Mmp17 A G 5: 129,606,405 E535G probably benign Het
Nfxl1 A T 5: 72,528,509 probably null Het
Nynrin A T 14: 55,863,532 T260S probably benign Het
Olfr1294 C T 2: 111,537,779 G170D probably damaging Het
Olfr859 A T 9: 19,808,975 Y219F possibly damaging Het
Olfr905 A T 9: 38,473,289 I181F possibly damaging Het
Pbx1 G T 1: 168,209,534 D109E probably damaging Het
Pde4d A T 13: 109,116,942 H101L probably benign Het
Pdlim3 T C 8: 45,908,602 I155T possibly damaging Het
Plekha5 T A 6: 140,525,929 Y26* probably null Het
Prpf6 T A 2: 181,621,920 L191* probably null Het
Rabl6 A G 2: 25,602,447 V80A possibly damaging Het
Rp1 T C 1: 4,311,280 probably benign Het
Sec14l1 A G 11: 117,156,850 S698G probably damaging Het
Skiv2l A G 17: 34,844,436 S622P possibly damaging Het
Slc19a1 G A 10: 77,049,606 G447S probably benign Het
Slc2a6 A T 2: 27,023,131 Y383* probably null Het
Slc9a9 C A 9: 94,936,371 Q273K probably benign Het
Spint2 A G 7: 29,263,706 Y56H probably damaging Het
Sspo T A 6: 48,495,212 M123K possibly damaging Het
Syne2 A G 12: 76,027,847 probably null Het
Trdn A C 10: 33,466,454 K619N probably benign Het
Ttll13 A G 7: 80,250,176 T119A possibly damaging Het
Ttn T C 2: 76,785,646 Y8324C probably damaging Het
Ttn T C 2: 76,898,258 probably benign Het
Vav2 A G 2: 27,296,219 L208P probably damaging Het
Vmn1r179 A G 7: 23,928,917 I178V probably benign Het
Vmn1r210 T C 13: 22,827,535 M194V possibly damaging Het
Vmn2r103 A T 17: 19,811,904 T647S probably benign Het
Wdr49 T A 3: 75,339,458 H289L probably benign Het
Wnk2 T G 13: 49,146,683 K184Q probably damaging Het
Zfp758 A G 17: 22,371,997 probably benign Het
Other mutations in Abhd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Abhd8 APN 8 71457319 missense probably damaging 1.00
IGL01780:Abhd8 APN 8 71461477 missense probably benign 0.00
IGL02350:Abhd8 APN 8 71461477 missense probably benign 0.00
IGL02357:Abhd8 APN 8 71461477 missense probably benign 0.00
PIT4142001:Abhd8 UTSW 8 71461855 missense probably damaging 1.00
R0135:Abhd8 UTSW 8 71458074 missense probably benign 0.20
R0142:Abhd8 UTSW 8 71461862 missense probably damaging 0.96
R1006:Abhd8 UTSW 8 71458441 missense probably benign 0.19
R1411:Abhd8 UTSW 8 71461730 missense probably damaging 1.00
R1676:Abhd8 UTSW 8 71461873 missense probably damaging 1.00
R1937:Abhd8 UTSW 8 71461862 missense possibly damaging 0.93
R1985:Abhd8 UTSW 8 71463513 unclassified probably benign
R3724:Abhd8 UTSW 8 71461492 missense probably benign 0.14
R5254:Abhd8 UTSW 8 71458398 nonsense probably null
R5770:Abhd8 UTSW 8 71457328 missense probably benign 0.07
R6030:Abhd8 UTSW 8 71458150 missense possibly damaging 0.94
R6030:Abhd8 UTSW 8 71458150 missense possibly damaging 0.94
R6474:Abhd8 UTSW 8 71461715 missense probably damaging 1.00
R6769:Abhd8 UTSW 8 71461461 missense probably damaging 1.00
R6771:Abhd8 UTSW 8 71461461 missense probably damaging 1.00
R7406:Abhd8 UTSW 8 71461762 missense probably benign
Z1088:Abhd8 UTSW 8 71461801 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCCAATGCGTAAAAGGTGTAG -3'
(R):5'- ATCACAGTGTACCGCAACG -3'

Sequencing Primer
(F):5'- TGCGTAAAAGGTGTAGGCAGC -3'
(R):5'- CAACGGGAGGCTGGTGG -3'
Posted On2018-06-06