Incidental Mutation 'R6501:Slc9a9'
ID519734
Institutional Source Beutler Lab
Gene Symbol Slc9a9
Ensembl Gene ENSMUSG00000031129
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 9
Synonyms5730527A11Rik, Nhe9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6501 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location94669909-95230445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 94936371 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 273 (Q273K)
Ref Sequence ENSEMBL: ENSMUSP00000033463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033463]
Predicted Effect probably benign
Transcript: ENSMUST00000033463
AA Change: Q273K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000033463
Gene: ENSMUSG00000031129
AA Change: Q273K

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 28 486 2.6e-89 PFAM
low complexity region 594 600 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
Meta Mutation Damage Score 0.1039 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium/proton exchanger that is a member of the solute carrier 9 protein family. The encoded protein localizes the to the late recycling endosomes and may play an important role in maintaining cation homeostasis. Mutations in this gene are associated with autism susceptibility 16 and attention-deficit/hyperactivity disorder. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,461,521 C154* probably null Het
Ada A G 2: 163,728,188 probably null Het
Birc6 G A 17: 74,579,281 V535I probably damaging Het
Bptf T C 11: 107,077,683 N1058S probably null Het
Cdadc1 C T 14: 59,586,449 C198Y probably benign Het
Chrna7 G A 7: 63,106,115 R228C probably damaging Het
Cts6 T C 13: 61,196,335 N301S probably damaging Het
Cts8 T A 13: 61,250,942 D250V probably damaging Het
Cyp26a1 G T 19: 37,699,070 R235L possibly damaging Het
Disc1 A T 8: 125,218,105 M598L probably benign Het
Ear6 T A 14: 51,854,224 V76D possibly damaging Het
Grifin A G 5: 140,563,281 *145R probably null Het
Htr2b T G 1: 86,110,641 E11A probably damaging Het
Krtap4-9 T A 11: 99,785,429 probably benign Het
Larp4b A C 13: 9,168,793 H522P probably damaging Het
Macf1 A T 4: 123,469,632 probably null Het
Mdfic T C 6: 15,770,517 L174P possibly damaging Het
Mmp17 A G 5: 129,606,405 E535G probably benign Het
Nfxl1 A T 5: 72,528,509 probably null Het
Nynrin A T 14: 55,863,532 T260S probably benign Het
Olfr1294 C T 2: 111,537,779 G170D probably damaging Het
Olfr859 A T 9: 19,808,975 Y219F possibly damaging Het
Olfr905 A T 9: 38,473,289 I181F possibly damaging Het
Pbx1 G T 1: 168,209,534 D109E probably damaging Het
Pde4d A T 13: 109,116,942 H101L probably benign Het
Pdlim3 T C 8: 45,908,602 I155T possibly damaging Het
Plekha5 T A 6: 140,525,929 Y26* probably null Het
Prpf6 T A 2: 181,621,920 L191* probably null Het
Rabl6 A G 2: 25,602,447 V80A possibly damaging Het
Rp1 T C 1: 4,311,280 probably benign Het
Sec14l1 A G 11: 117,156,850 S698G probably damaging Het
Skiv2l A G 17: 34,844,436 S622P possibly damaging Het
Slc19a1 G A 10: 77,049,606 G447S probably benign Het
Slc2a6 A T 2: 27,023,131 Y383* probably null Het
Spint2 A G 7: 29,263,706 Y56H probably damaging Het
Sspo T A 6: 48,495,212 M123K possibly damaging Het
Syne2 A G 12: 76,027,847 probably null Het
Trdn A C 10: 33,466,454 K619N probably benign Het
Ttll13 A G 7: 80,250,176 T119A possibly damaging Het
Ttn T C 2: 76,785,646 Y8324C probably damaging Het
Ttn T C 2: 76,898,258 probably benign Het
Vav2 A G 2: 27,296,219 L208P probably damaging Het
Vmn1r179 A G 7: 23,928,917 I178V probably benign Het
Vmn1r210 T C 13: 22,827,535 M194V possibly damaging Het
Vmn2r103 A T 17: 19,811,904 T647S probably benign Het
Wdr49 T A 3: 75,339,458 H289L probably benign Het
Wnk2 T G 13: 49,146,683 K184Q probably damaging Het
Zfp758 A G 17: 22,371,997 probably benign Het
Other mutations in Slc9a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Slc9a9 APN 9 95055459 missense probably benign 0.03
IGL01394:Slc9a9 APN 9 95123037 missense probably benign
IGL01434:Slc9a9 APN 9 95019194 missense possibly damaging 0.49
IGL01715:Slc9a9 APN 9 94960446 missense probably damaging 1.00
IGL01821:Slc9a9 APN 9 95228950 missense probably benign
IGL02963:Slc9a9 APN 9 95020714 critical splice donor site probably null
IGL03211:Slc9a9 APN 9 95137990 splice site probably benign
ANU18:Slc9a9 UTSW 9 95055459 missense probably benign 0.03
R0306:Slc9a9 UTSW 9 95137934 missense probably benign
R0382:Slc9a9 UTSW 9 94685217 missense probably benign 0.18
R0388:Slc9a9 UTSW 9 94939563 critical splice donor site probably null
R1509:Slc9a9 UTSW 9 95228958 missense probably benign
R1785:Slc9a9 UTSW 9 95019193 missense possibly damaging 0.95
R4018:Slc9a9 UTSW 9 94685163 missense probably benign 0.03
R4167:Slc9a9 UTSW 9 95228899 missense probably damaging 0.98
R4170:Slc9a9 UTSW 9 95228899 missense probably damaging 0.98
R4695:Slc9a9 UTSW 9 94936449 critical splice donor site probably benign
R5400:Slc9a9 UTSW 9 94712901 missense probably damaging 1.00
R5609:Slc9a9 UTSW 9 94809937 missense probably damaging 1.00
R5684:Slc9a9 UTSW 9 95055508 missense possibly damaging 0.89
R6015:Slc9a9 UTSW 9 94939549 missense probably benign 0.29
R6102:Slc9a9 UTSW 9 94936429 missense probably benign 0.03
R6317:Slc9a9 UTSW 9 94939459 missense possibly damaging 0.51
R6398:Slc9a9 UTSW 9 94670227 missense probably benign 0.00
R6476:Slc9a9 UTSW 9 94685138 missense probably benign 0.00
R6603:Slc9a9 UTSW 9 94939546 missense probably damaging 0.98
R6611:Slc9a9 UTSW 9 94939478 missense probably benign 0.18
R6700:Slc9a9 UTSW 9 94936311 missense possibly damaging 0.66
R6824:Slc9a9 UTSW 9 95227198 missense probably damaging 1.00
R6931:Slc9a9 UTSW 9 94670086 missense possibly damaging 0.73
R6975:Slc9a9 UTSW 9 94960446 missense probably damaging 1.00
R6987:Slc9a9 UTSW 9 94669990 start gained probably benign
R7325:Slc9a9 UTSW 9 94712898 missense probably benign 0.24
R7374:Slc9a9 UTSW 9 95055489 missense possibly damaging 0.90
R7437:Slc9a9 UTSW 9 95228941 missense probably benign 0.00
R7614:Slc9a9 UTSW 9 94855739 missense probably damaging 1.00
X0010:Slc9a9 UTSW 9 94685208 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGGTTTATCTCACCAGCACC -3'
(R):5'- TGCTACTGATCCAGTGCCTC -3'

Sequencing Primer
(F):5'- CCAGCCTCATTGGAAAGTGTG -3'
(R):5'- TACTGATCCAGTGCCTCATGGG -3'
Posted On2018-06-06