Incidental Mutation 'R6501:Cts6'
ID519744
Institutional Source Beutler Lab
Gene Symbol Cts6
Ensembl Gene ENSMUSG00000021441
Gene Namecathepsin 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6501 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location61195132-61203410 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61196335 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 301 (N301S)
Ref Sequence ENSEMBL: ENSMUSP00000021890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021890]
Predicted Effect probably damaging
Transcript: ENSMUST00000021890
AA Change: N301S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021890
Gene: ENSMUSG00000021441
AA Change: N301S

DomainStartEndE-ValueType
Inhibitor_I29 29 88 3.17e-22 SMART
Pept_C1 115 333 9.61e-111 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,461,521 C154* probably null Het
Ada A G 2: 163,728,188 probably null Het
Birc6 G A 17: 74,579,281 V535I probably damaging Het
Bptf T C 11: 107,077,683 N1058S probably null Het
Cdadc1 C T 14: 59,586,449 C198Y probably benign Het
Chrna7 G A 7: 63,106,115 R228C probably damaging Het
Cts8 T A 13: 61,250,942 D250V probably damaging Het
Cyp26a1 G T 19: 37,699,070 R235L possibly damaging Het
Disc1 A T 8: 125,218,105 M598L probably benign Het
Ear6 T A 14: 51,854,224 V76D possibly damaging Het
Grifin A G 5: 140,563,281 *145R probably null Het
Htr2b T G 1: 86,110,641 E11A probably damaging Het
Krtap4-9 T A 11: 99,785,429 probably benign Het
Larp4b A C 13: 9,168,793 H522P probably damaging Het
Macf1 A T 4: 123,469,632 probably null Het
Mdfic T C 6: 15,770,517 L174P possibly damaging Het
Mmp17 A G 5: 129,606,405 E535G probably benign Het
Nfxl1 A T 5: 72,528,509 probably null Het
Nynrin A T 14: 55,863,532 T260S probably benign Het
Olfr1294 C T 2: 111,537,779 G170D probably damaging Het
Olfr859 A T 9: 19,808,975 Y219F possibly damaging Het
Olfr905 A T 9: 38,473,289 I181F possibly damaging Het
Pbx1 G T 1: 168,209,534 D109E probably damaging Het
Pde4d A T 13: 109,116,942 H101L probably benign Het
Pdlim3 T C 8: 45,908,602 I155T possibly damaging Het
Plekha5 T A 6: 140,525,929 Y26* probably null Het
Prpf6 T A 2: 181,621,920 L191* probably null Het
Rabl6 A G 2: 25,602,447 V80A possibly damaging Het
Rp1 T C 1: 4,311,280 probably benign Het
Sec14l1 A G 11: 117,156,850 S698G probably damaging Het
Skiv2l A G 17: 34,844,436 S622P possibly damaging Het
Slc19a1 G A 10: 77,049,606 G447S probably benign Het
Slc2a6 A T 2: 27,023,131 Y383* probably null Het
Slc9a9 C A 9: 94,936,371 Q273K probably benign Het
Spint2 A G 7: 29,263,706 Y56H probably damaging Het
Sspo T A 6: 48,495,212 M123K possibly damaging Het
Syne2 A G 12: 76,027,847 probably null Het
Trdn A C 10: 33,466,454 K619N probably benign Het
Ttll13 A G 7: 80,250,176 T119A possibly damaging Het
Ttn T C 2: 76,785,646 Y8324C probably damaging Het
Ttn T C 2: 76,898,258 probably benign Het
Vav2 A G 2: 27,296,219 L208P probably damaging Het
Vmn1r179 A G 7: 23,928,917 I178V probably benign Het
Vmn1r210 T C 13: 22,827,535 M194V possibly damaging Het
Vmn2r103 A T 17: 19,811,904 T647S probably benign Het
Wdr49 T A 3: 75,339,458 H289L probably benign Het
Wnk2 T G 13: 49,146,683 K184Q probably damaging Het
Zfp758 A G 17: 22,371,997 probably benign Het
Other mutations in Cts6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Cts6 APN 13 61198339 splice site probably benign
IGL00774:Cts6 APN 13 61198339 splice site probably benign
IGL02237:Cts6 APN 13 61197499 missense probably benign 0.01
IGL03071:Cts6 APN 13 61202250 missense probably damaging 0.97
IGL03224:Cts6 APN 13 61201733 missense probably damaging 1.00
IGL03282:Cts6 APN 13 61196447 missense possibly damaging 0.56
R0086:Cts6 UTSW 13 61196457 splice site probably benign
R0201:Cts6 UTSW 13 61201499 nonsense probably null
R0238:Cts6 UTSW 13 61201819 missense probably damaging 1.00
R0238:Cts6 UTSW 13 61201819 missense probably damaging 1.00
R0401:Cts6 UTSW 13 61198339 splice site probably benign
R0676:Cts6 UTSW 13 61197484 splice site probably benign
R1471:Cts6 UTSW 13 61196380 missense probably benign 0.00
R1594:Cts6 UTSW 13 61198367 missense probably damaging 1.00
R1864:Cts6 UTSW 13 61201579 missense probably benign 0.26
R1865:Cts6 UTSW 13 61201579 missense probably benign 0.26
R1902:Cts6 UTSW 13 61201515 nonsense probably null
R2097:Cts6 UTSW 13 61195445 missense probably damaging 1.00
R2235:Cts6 UTSW 13 61195433 missense probably damaging 1.00
R2829:Cts6 UTSW 13 61201497 missense probably benign 0.01
R2910:Cts6 UTSW 13 61196401 missense probably damaging 1.00
R3757:Cts6 UTSW 13 61202158 nonsense probably null
R4460:Cts6 UTSW 13 61195458 missense probably benign 0.25
R4553:Cts6 UTSW 13 61197593 missense probably damaging 1.00
R4623:Cts6 UTSW 13 61202160 missense possibly damaging 0.57
R4793:Cts6 UTSW 13 61201812 missense probably benign 0.00
R4809:Cts6 UTSW 13 61202181 missense probably damaging 1.00
R4849:Cts6 UTSW 13 61201601 missense probably null
R4866:Cts6 UTSW 13 61202276 critical splice acceptor site probably null
R5055:Cts6 UTSW 13 61196350 missense probably damaging 1.00
R5590:Cts6 UTSW 13 61201812 missense probably benign 0.00
R6236:Cts6 UTSW 13 61196378 nonsense probably null
R6428:Cts6 UTSW 13 61196423 missense probably damaging 0.96
R6508:Cts6 UTSW 13 61196407 missense probably damaging 1.00
R6643:Cts6 UTSW 13 61201793 missense probably damaging 0.96
R7397:Cts6 UTSW 13 61202200 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGCATCAGACCTCTACAAATGTTC -3'
(R):5'- AGTGGTCACTGTCATGTGTC -3'

Sequencing Primer
(F):5'- CATGCCACTCCATATTTACATAGG -3'
(R):5'- TGTGTCATGGATGCCACAC -3'
Posted On2018-06-06