Incidental Mutation 'R6501:Nynrin'
ID519748
Institutional Source Beutler Lab
Gene Symbol Nynrin
Ensembl Gene ENSMUSG00000075592
Gene NameNYN domain and retroviral integrase containing
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6501 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55854010-55874736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55863532 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 260 (T260S)
Ref Sequence ENSEMBL: ENSMUSP00000129557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100529] [ENSMUST00000168479] [ENSMUST00000227465]
Predicted Effect probably benign
Transcript: ENSMUST00000100529
AA Change: T260S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098098
Gene: ENSMUSG00000075592
AA Change: T260S

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 1.6e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168479
AA Change: T260S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129557
Gene: ENSMUSG00000075592
AA Change: T260S

DomainStartEndE-ValueType
low complexity region 581 606 N/A INTRINSIC
Pfam:RNase_Zc3h12a 739 890 5.5e-54 PFAM
low complexity region 938 952 N/A INTRINSIC
low complexity region 1212 1228 N/A INTRINSIC
low complexity region 1390 1397 N/A INTRINSIC
PDB:3S3O|B 1478 1706 6e-8 PDB
SCOP:d1cxqa_ 1552 1646 2e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181218
Predicted Effect probably benign
Transcript: ENSMUST00000227465
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,461,521 C154* probably null Het
Ada A G 2: 163,728,188 probably null Het
Birc6 G A 17: 74,579,281 V535I probably damaging Het
Bptf T C 11: 107,077,683 N1058S probably null Het
Cdadc1 C T 14: 59,586,449 C198Y probably benign Het
Chrna7 G A 7: 63,106,115 R228C probably damaging Het
Cts6 T C 13: 61,196,335 N301S probably damaging Het
Cts8 T A 13: 61,250,942 D250V probably damaging Het
Cyp26a1 G T 19: 37,699,070 R235L possibly damaging Het
Disc1 A T 8: 125,218,105 M598L probably benign Het
Ear6 T A 14: 51,854,224 V76D possibly damaging Het
Grifin A G 5: 140,563,281 *145R probably null Het
Htr2b T G 1: 86,110,641 E11A probably damaging Het
Krtap4-9 T A 11: 99,785,429 probably benign Het
Larp4b A C 13: 9,168,793 H522P probably damaging Het
Macf1 A T 4: 123,469,632 probably null Het
Mdfic T C 6: 15,770,517 L174P possibly damaging Het
Mmp17 A G 5: 129,606,405 E535G probably benign Het
Nfxl1 A T 5: 72,528,509 probably null Het
Olfr1294 C T 2: 111,537,779 G170D probably damaging Het
Olfr859 A T 9: 19,808,975 Y219F possibly damaging Het
Olfr905 A T 9: 38,473,289 I181F possibly damaging Het
Pbx1 G T 1: 168,209,534 D109E probably damaging Het
Pde4d A T 13: 109,116,942 H101L probably benign Het
Pdlim3 T C 8: 45,908,602 I155T possibly damaging Het
Plekha5 T A 6: 140,525,929 Y26* probably null Het
Prpf6 T A 2: 181,621,920 L191* probably null Het
Rabl6 A G 2: 25,602,447 V80A possibly damaging Het
Rp1 T C 1: 4,311,280 probably benign Het
Sec14l1 A G 11: 117,156,850 S698G probably damaging Het
Skiv2l A G 17: 34,844,436 S622P possibly damaging Het
Slc19a1 G A 10: 77,049,606 G447S probably benign Het
Slc2a6 A T 2: 27,023,131 Y383* probably null Het
Slc9a9 C A 9: 94,936,371 Q273K probably benign Het
Spint2 A G 7: 29,263,706 Y56H probably damaging Het
Sspo T A 6: 48,495,212 M123K possibly damaging Het
Syne2 A G 12: 76,027,847 probably null Het
Trdn A C 10: 33,466,454 K619N probably benign Het
Ttll13 A G 7: 80,250,176 T119A possibly damaging Het
Ttn T C 2: 76,785,646 Y8324C probably damaging Het
Ttn T C 2: 76,898,258 probably benign Het
Vav2 A G 2: 27,296,219 L208P probably damaging Het
Vmn1r179 A G 7: 23,928,917 I178V probably benign Het
Vmn1r210 T C 13: 22,827,535 M194V possibly damaging Het
Vmn2r103 A T 17: 19,811,904 T647S probably benign Het
Wdr49 T A 3: 75,339,458 H289L probably benign Het
Wnk2 T G 13: 49,146,683 K184Q probably damaging Het
Zfp758 A G 17: 22,371,997 probably benign Het
Other mutations in Nynrin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Nynrin APN 14 55868448 missense probably benign 0.38
IGL01131:Nynrin APN 14 55872685 missense probably damaging 1.00
IGL01357:Nynrin APN 14 55870417 missense probably benign
IGL01537:Nynrin APN 14 55872045 missense possibly damaging 0.87
IGL01583:Nynrin APN 14 55870511 missense probably damaging 1.00
IGL01726:Nynrin APN 14 55864154 missense probably benign
IGL02161:Nynrin APN 14 55863984 missense probably damaging 1.00
IGL02167:Nynrin APN 14 55863335 missense probably damaging 1.00
IGL02247:Nynrin APN 14 55871710 nonsense probably null
IGL02302:Nynrin APN 14 55868505 missense probably benign 0.43
IGL02524:Nynrin APN 14 55871474 missense possibly damaging 0.73
IGL02600:Nynrin APN 14 55863992 missense probably benign 0.38
IGL02639:Nynrin APN 14 55870655 missense probably damaging 1.00
IGL02654:Nynrin APN 14 55863259 missense possibly damaging 0.95
IGL02659:Nynrin APN 14 55866097 unclassified probably benign
IGL02736:Nynrin APN 14 55870909 missense probably damaging 1.00
IGL02949:Nynrin APN 14 55872380 missense probably damaging 0.99
PIT4458001:Nynrin UTSW 14 55863968 missense probably benign 0.39
R0017:Nynrin UTSW 14 55872395 missense probably damaging 1.00
R0078:Nynrin UTSW 14 55863332 missense probably damaging 1.00
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0211:Nynrin UTSW 14 55871798 missense probably benign 0.08
R0413:Nynrin UTSW 14 55872191 missense possibly damaging 0.90
R0609:Nynrin UTSW 14 55872761 missense probably damaging 1.00
R0626:Nynrin UTSW 14 55868035 missense probably damaging 1.00
R1205:Nynrin UTSW 14 55854189 intron probably benign
R1222:Nynrin UTSW 14 55863541 missense probably benign 0.02
R1385:Nynrin UTSW 14 55864899 missense probably benign 0.00
R1820:Nynrin UTSW 14 55870378 missense possibly damaging 0.95
R1829:Nynrin UTSW 14 55872947 missense possibly damaging 0.50
R1874:Nynrin UTSW 14 55863493 missense probably benign 0.04
R1927:Nynrin UTSW 14 55863592 missense probably benign 0.00
R2233:Nynrin UTSW 14 55872067 missense possibly damaging 0.83
R3018:Nynrin UTSW 14 55863410 missense probably benign 0.00
R3154:Nynrin UTSW 14 55863587 missense possibly damaging 0.46
R3853:Nynrin UTSW 14 55864105 missense probably benign 0.24
R4648:Nynrin UTSW 14 55872894 nonsense probably null
R4722:Nynrin UTSW 14 55854395 missense probably damaging 0.97
R4735:Nynrin UTSW 14 55870168 missense probably benign 0.03
R4736:Nynrin UTSW 14 55863997 missense probably damaging 1.00
R4780:Nynrin UTSW 14 55863263 missense probably damaging 1.00
R4804:Nynrin UTSW 14 55864869 missense probably benign
R4816:Nynrin UTSW 14 55872001 missense probably damaging 1.00
R5307:Nynrin UTSW 14 55863806 missense probably damaging 1.00
R5372:Nynrin UTSW 14 55868491 missense probably benign 0.01
R5432:Nynrin UTSW 14 55864466 missense possibly damaging 0.80
R5800:Nynrin UTSW 14 55870631 missense probably damaging 1.00
R5825:Nynrin UTSW 14 55864226 missense probably benign 0.00
R6149:Nynrin UTSW 14 55854323 missense possibly damaging 0.83
R6244:Nynrin UTSW 14 55868028 missense probably damaging 1.00
R6350:Nynrin UTSW 14 55868076 missense probably benign 0.19
R6379:Nynrin UTSW 14 55870391 missense probably damaging 1.00
R6437:Nynrin UTSW 14 55871770 missense probably benign 0.00
R6702:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6703:Nynrin UTSW 14 55864478 missense possibly damaging 0.80
R6907:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6908:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6928:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6934:Nynrin UTSW 14 55863878 missense probably benign 0.20
R6935:Nynrin UTSW 14 55863878 missense probably benign 0.20
R7197:Nynrin UTSW 14 55871923 missense probably benign 0.00
R7204:Nynrin UTSW 14 55872733 missense probably damaging 1.00
R7272:Nynrin UTSW 14 55870415 missense probably damaging 1.00
R7335:Nynrin UTSW 14 55863914 missense probably benign
R7361:Nynrin UTSW 14 55870400 missense possibly damaging 0.71
R7368:Nynrin UTSW 14 55870511 missense probably damaging 1.00
R7443:Nynrin UTSW 14 55871416 missense probably benign 0.18
R7584:Nynrin UTSW 14 55871584 missense probably damaging 1.00
R7677:Nynrin UTSW 14 55870236 missense probably benign
R7723:Nynrin UTSW 14 55872045 missense possibly damaging 0.87
R7776:Nynrin UTSW 14 55865963 missense probably damaging 1.00
R7787:Nynrin UTSW 14 55870523 missense probably benign
R7842:Nynrin UTSW 14 55865096 missense probably damaging 1.00
R7852:Nynrin UTSW 14 55871429 missense probably damaging 0.96
R7925:Nynrin UTSW 14 55865096 missense probably damaging 1.00
R7935:Nynrin UTSW 14 55871429 missense probably damaging 0.96
R8040:Nynrin UTSW 14 55871525 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACATCATTGAGTGGCTCGG -3'
(R):5'- ACCTTGCTTGTTAGACTGGTCC -3'

Sequencing Primer
(F):5'- TGGCATCTCTGGTACTTG -3'
(R):5'- TTAGACTGGTCCCTAGAGAAAGTCC -3'
Posted On2018-06-06