Incidental Mutation 'R6501:Cdadc1'
ID519749
Institutional Source Beutler Lab
Gene Symbol Cdadc1
Ensembl Gene ENSMUSG00000021982
Gene Namecytidine and dCMP deaminase domain containing 1
Synonyms2310010M10Rik, NYD-SP15
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R6501 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location59559388-59597959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59586449 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 198 (C198Y)
Ref Sequence ENSEMBL: ENSMUSP00000153357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022555] [ENSMUST00000056997] [ENSMUST00000167100] [ENSMUST00000171683] [ENSMUST00000225595] [ENSMUST00000225839]
Predicted Effect probably benign
Transcript: ENSMUST00000022555
AA Change: C198Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000022555
Gene: ENSMUSG00000021982
AA Change: C198Y

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 73 153 9.2e-8 PFAM
Pfam:dCMP_cyt_deam_1 317 446 4.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056997
AA Change: C198Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000052233
Gene: ENSMUSG00000021982
AA Change: C198Y

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 73 153 9.8e-8 PFAM
Pfam:dCMP_cyt_deam_1 317 446 4.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167100
AA Change: C198Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128022
Gene: ENSMUSG00000021982
AA Change: C198Y

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 74 153 4.9e-9 PFAM
Pfam:dCMP_cyt_deam_1 317 446 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171683
AA Change: C198Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128064
Gene: ENSMUSG00000021982
AA Change: C198Y

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 74 153 1.4e-8 PFAM
Pfam:dCMP_cyt_deam_1 317 446 3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225103
Predicted Effect probably benign
Transcript: ENSMUST00000225595
Predicted Effect probably benign
Transcript: ENSMUST00000225839
AA Change: C198Y

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,461,521 C154* probably null Het
Ada A G 2: 163,728,188 probably null Het
Birc6 G A 17: 74,579,281 V535I probably damaging Het
Bptf T C 11: 107,077,683 N1058S probably null Het
Chrna7 G A 7: 63,106,115 R228C probably damaging Het
Cts6 T C 13: 61,196,335 N301S probably damaging Het
Cts8 T A 13: 61,250,942 D250V probably damaging Het
Cyp26a1 G T 19: 37,699,070 R235L possibly damaging Het
Disc1 A T 8: 125,218,105 M598L probably benign Het
Ear6 T A 14: 51,854,224 V76D possibly damaging Het
Grifin A G 5: 140,563,281 *145R probably null Het
Htr2b T G 1: 86,110,641 E11A probably damaging Het
Krtap4-9 T A 11: 99,785,429 probably benign Het
Larp4b A C 13: 9,168,793 H522P probably damaging Het
Macf1 A T 4: 123,469,632 probably null Het
Mdfic T C 6: 15,770,517 L174P possibly damaging Het
Mmp17 A G 5: 129,606,405 E535G probably benign Het
Nfxl1 A T 5: 72,528,509 probably null Het
Nynrin A T 14: 55,863,532 T260S probably benign Het
Olfr1294 C T 2: 111,537,779 G170D probably damaging Het
Olfr859 A T 9: 19,808,975 Y219F possibly damaging Het
Olfr905 A T 9: 38,473,289 I181F possibly damaging Het
Pbx1 G T 1: 168,209,534 D109E probably damaging Het
Pde4d A T 13: 109,116,942 H101L probably benign Het
Pdlim3 T C 8: 45,908,602 I155T possibly damaging Het
Plekha5 T A 6: 140,525,929 Y26* probably null Het
Prpf6 T A 2: 181,621,920 L191* probably null Het
Rabl6 A G 2: 25,602,447 V80A possibly damaging Het
Rp1 T C 1: 4,311,280 probably benign Het
Sec14l1 A G 11: 117,156,850 S698G probably damaging Het
Skiv2l A G 17: 34,844,436 S622P possibly damaging Het
Slc19a1 G A 10: 77,049,606 G447S probably benign Het
Slc2a6 A T 2: 27,023,131 Y383* probably null Het
Slc9a9 C A 9: 94,936,371 Q273K probably benign Het
Spint2 A G 7: 29,263,706 Y56H probably damaging Het
Sspo T A 6: 48,495,212 M123K possibly damaging Het
Syne2 A G 12: 76,027,847 probably null Het
Trdn A C 10: 33,466,454 K619N probably benign Het
Ttll13 A G 7: 80,250,176 T119A possibly damaging Het
Ttn T C 2: 76,785,646 Y8324C probably damaging Het
Ttn T C 2: 76,898,258 probably benign Het
Vav2 A G 2: 27,296,219 L208P probably damaging Het
Vmn1r179 A G 7: 23,928,917 I178V probably benign Het
Vmn1r210 T C 13: 22,827,535 M194V possibly damaging Het
Vmn2r103 A T 17: 19,811,904 T647S probably benign Het
Wdr49 T A 3: 75,339,458 H289L probably benign Het
Wnk2 T G 13: 49,146,683 K184Q probably damaging Het
Zfp758 A G 17: 22,371,997 probably benign Het
Other mutations in Cdadc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Cdadc1 APN 14 59581369 missense probably damaging 1.00
IGL01897:Cdadc1 APN 14 59592537 critical splice acceptor site probably null
IGL02648:Cdadc1 APN 14 59586363 missense probably damaging 1.00
IGL02720:Cdadc1 APN 14 59586047 missense probably damaging 1.00
R0254:Cdadc1 UTSW 14 59575907 splice site probably benign
R0470:Cdadc1 UTSW 14 59573841 splice site probably benign
R0554:Cdadc1 UTSW 14 59586452 missense probably damaging 1.00
R1462:Cdadc1 UTSW 14 59575858 missense probably damaging 1.00
R1462:Cdadc1 UTSW 14 59575858 missense probably damaging 1.00
R1540:Cdadc1 UTSW 14 59586083 missense probably damaging 1.00
R1540:Cdadc1 UTSW 14 59586092 missense probably damaging 1.00
R1649:Cdadc1 UTSW 14 59573793 missense probably damaging 1.00
R1900:Cdadc1 UTSW 14 59586532 missense probably damaging 1.00
R1934:Cdadc1 UTSW 14 59589860 missense possibly damaging 0.91
R1976:Cdadc1 UTSW 14 59573768 missense probably damaging 1.00
R2061:Cdadc1 UTSW 14 59581334 missense probably damaging 1.00
R2136:Cdadc1 UTSW 14 59568044 splice site probably null
R2147:Cdadc1 UTSW 14 59597753 critical splice donor site probably null
R2929:Cdadc1 UTSW 14 59597835 start codon destroyed probably null 0.70
R2991:Cdadc1 UTSW 14 59586072 missense possibly damaging 0.68
R4179:Cdadc1 UTSW 14 59592486 missense probably benign 0.12
R4621:Cdadc1 UTSW 14 59586555 missense probably benign 0.00
R4814:Cdadc1 UTSW 14 59568991 frame shift probably null
R4816:Cdadc1 UTSW 14 59568991 frame shift probably null
R4817:Cdadc1 UTSW 14 59568991 frame shift probably null
R4872:Cdadc1 UTSW 14 59564524 missense probably benign 0.04
R5448:Cdadc1 UTSW 14 59573826 missense possibly damaging 0.94
R5642:Cdadc1 UTSW 14 59589923 missense possibly damaging 0.95
R5732:Cdadc1 UTSW 14 59596911 missense probably damaging 0.99
R6472:Cdadc1 UTSW 14 59586042 missense probably damaging 0.99
R7332:Cdadc1 UTSW 14 59575764 missense possibly damaging 0.63
X0064:Cdadc1 UTSW 14 59575854 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGCTCTCCAGACCTATAGTC -3'
(R):5'- TTGGCTTGCATCAGTGACC -3'

Sequencing Primer
(F):5'- ATAGTCATCAGTATCTGCTTATGCC -3'
(R):5'- GGCTTGCATCAGTGACCTTTTC -3'
Posted On2018-06-06