Incidental Mutation 'R6501:Vmn2r103'
ID 519750
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Name vomeronasal 2, receptor 103
Synonyms EG627636
MMRRC Submission 044633-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R6501 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 19993625-20032798 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20032166 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 647 (T647S)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
AlphaFold E9PWW0
Predicted Effect probably benign
Transcript: ENSMUST00000172203
AA Change: T647S

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: T647S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 A T 8: 71,914,165 (GRCm39) C154* probably null Het
Ada A G 2: 163,570,108 (GRCm39) probably null Het
Birc6 G A 17: 74,886,276 (GRCm39) V535I probably damaging Het
Bptf T C 11: 106,968,509 (GRCm39) N1058S probably null Het
Cdadc1 C T 14: 59,823,898 (GRCm39) C198Y probably benign Het
Chrna7 G A 7: 62,755,863 (GRCm39) R228C probably damaging Het
Cts6 T C 13: 61,344,149 (GRCm39) N301S probably damaging Het
Cts8 T A 13: 61,398,756 (GRCm39) D250V probably damaging Het
Cyp26a1 G T 19: 37,687,518 (GRCm39) R235L possibly damaging Het
Disc1 A T 8: 125,944,844 (GRCm39) M598L probably benign Het
Ear6 T A 14: 52,091,681 (GRCm39) V76D possibly damaging Het
Grifin A G 5: 140,549,036 (GRCm39) *145R probably null Het
Htr2b T G 1: 86,038,363 (GRCm39) E11A probably damaging Het
Krtap4-9 T A 11: 99,676,255 (GRCm39) probably benign Het
Larp4b A C 13: 9,218,829 (GRCm39) H522P probably damaging Het
Macf1 A T 4: 123,363,425 (GRCm39) probably null Het
Mdfic T C 6: 15,770,516 (GRCm39) L174P possibly damaging Het
Mmp17 A G 5: 129,683,469 (GRCm39) E535G probably benign Het
Nfxl1 A T 5: 72,685,852 (GRCm39) probably null Het
Nynrin A T 14: 56,100,989 (GRCm39) T260S probably benign Het
Or4k44 C T 2: 111,368,124 (GRCm39) G170D probably damaging Het
Or7e168 A T 9: 19,720,271 (GRCm39) Y219F possibly damaging Het
Or8b1c A T 9: 38,384,585 (GRCm39) I181F possibly damaging Het
Pbx1 G T 1: 168,037,103 (GRCm39) D109E probably damaging Het
Pde4d A T 13: 109,253,476 (GRCm39) H101L probably benign Het
Pdlim3 T C 8: 46,361,639 (GRCm39) I155T possibly damaging Het
Plekha5 T A 6: 140,471,655 (GRCm39) Y26* probably null Het
Prpf6 T A 2: 181,263,713 (GRCm39) L191* probably null Het
Rabl6 A G 2: 25,492,459 (GRCm39) V80A possibly damaging Het
Rp1 T C 1: 4,381,503 (GRCm39) probably benign Het
Sec14l1 A G 11: 117,047,676 (GRCm39) S698G probably damaging Het
Skic2 A G 17: 35,063,412 (GRCm39) S622P possibly damaging Het
Slc19a1 G A 10: 76,885,440 (GRCm39) G447S probably benign Het
Slc2a6 A T 2: 26,913,143 (GRCm39) Y383* probably null Het
Slc9a9 C A 9: 94,818,424 (GRCm39) Q273K probably benign Het
Spint2 A G 7: 28,963,131 (GRCm39) Y56H probably damaging Het
Sspo T A 6: 48,472,146 (GRCm39) M123K possibly damaging Het
Syne2 A G 12: 76,074,621 (GRCm39) probably null Het
Trdn A C 10: 33,342,450 (GRCm39) K619N probably benign Het
Ttll13 A G 7: 79,899,924 (GRCm39) T119A possibly damaging Het
Ttn T C 2: 76,615,990 (GRCm39) Y8324C probably damaging Het
Ttn T C 2: 76,728,602 (GRCm39) probably benign Het
Vav2 A G 2: 27,186,231 (GRCm39) L208P probably damaging Het
Vmn1r179 A G 7: 23,628,342 (GRCm39) I178V probably benign Het
Vmn1r210 T C 13: 23,011,705 (GRCm39) M194V possibly damaging Het
Wdr49 T A 3: 75,246,765 (GRCm39) H289L probably benign Het
Wnk2 T G 13: 49,300,159 (GRCm39) K184Q probably damaging Het
Zfp758 A G 17: 22,590,978 (GRCm39) probably benign Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 20,013,364 (GRCm39) missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 20,015,227 (GRCm39) missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 20,013,259 (GRCm39) missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 20,013,229 (GRCm39) missense probably benign
IGL01404:Vmn2r103 APN 17 20,032,696 (GRCm39) missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 20,014,330 (GRCm39) missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 20,019,470 (GRCm39) missense probably benign
IGL02251:Vmn2r103 APN 17 20,014,231 (GRCm39) missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19,993,631 (GRCm39) missense probably benign
IGL02555:Vmn2r103 APN 17 20,031,873 (GRCm39) missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 20,014,389 (GRCm39) missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 20,014,218 (GRCm39) missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 20,032,510 (GRCm39) missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19,993,782 (GRCm39) missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 20,032,241 (GRCm39) missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 20,031,903 (GRCm39) missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 20,013,726 (GRCm39) missense probably benign 0.12
R0375:Vmn2r103 UTSW 17 20,013,121 (GRCm39) missense probably benign 0.06
R0755:Vmn2r103 UTSW 17 19,993,830 (GRCm39) missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 20,014,189 (GRCm39) missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 20,014,509 (GRCm39) missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 20,013,230 (GRCm39) missense probably benign
R1488:Vmn2r103 UTSW 17 20,013,922 (GRCm39) missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19,993,662 (GRCm39) missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 20,014,496 (GRCm39) missense probably benign
R1928:Vmn2r103 UTSW 17 20,032,029 (GRCm39) missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 20,032,562 (GRCm39) missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 20,014,056 (GRCm39) missense probably benign
R2219:Vmn2r103 UTSW 17 20,013,909 (GRCm39) missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19,993,793 (GRCm39) missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 20,013,862 (GRCm39) missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 20,032,411 (GRCm39) missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 20,014,495 (GRCm39) missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 20,032,077 (GRCm39) missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 20,032,031 (GRCm39) missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 20,032,433 (GRCm39) missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 20,013,904 (GRCm39) missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 20,013,251 (GRCm39) missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 20,015,201 (GRCm39) missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 20,032,715 (GRCm39) missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 20,014,478 (GRCm39) nonsense probably null
R6114:Vmn2r103 UTSW 17 20,032,587 (GRCm39) missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 20,032,406 (GRCm39) missense probably benign
R6292:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 20,014,344 (GRCm39) missense probably damaging 0.97
R6710:Vmn2r103 UTSW 17 20,032,239 (GRCm39) missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 20,013,739 (GRCm39) missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 20,032,314 (GRCm39) missense probably damaging 0.99
R7816:Vmn2r103 UTSW 17 20,014,476 (GRCm39) missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 20,013,385 (GRCm39) missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 20,019,511 (GRCm39) missense probably damaging 1.00
R8031:Vmn2r103 UTSW 17 20,013,759 (GRCm39) missense probably benign 0.00
R8140:Vmn2r103 UTSW 17 20,032,058 (GRCm39) missense probably damaging 1.00
R8186:Vmn2r103 UTSW 17 20,032,205 (GRCm39) missense probably damaging 1.00
R8559:Vmn2r103 UTSW 17 20,032,646 (GRCm39) missense probably benign 0.01
R9413:Vmn2r103 UTSW 17 20,032,158 (GRCm39) missense possibly damaging 0.54
R9591:Vmn2r103 UTSW 17 20,031,921 (GRCm39) missense possibly damaging 0.70
R9652:Vmn2r103 UTSW 17 20,014,027 (GRCm39) missense probably benign 0.01
R9680:Vmn2r103 UTSW 17 20,019,525 (GRCm39) nonsense probably null
R9743:Vmn2r103 UTSW 17 20,032,475 (GRCm39) missense probably damaging 1.00
Z1088:Vmn2r103 UTSW 17 20,015,309 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GTGATCTTTCTTGCCTATGAAGACC -3'
(R):5'- GCTGGATCAGGGTGCATATAG -3'

Sequencing Primer
(F):5'- GATGACTCTAGCCAGCGTAG -3'
(R):5'- ATAGGAATGATGTAGTTTGGACCCC -3'
Posted On 2018-06-06