Mutagenetix > Incidental Mutation

Incidental Mutation 'R6502:Hmcn2'

519763

Institutional Source

Beutler Lab

Gene Symbol

Hmcn2

Ensembl Gene

ENSMUSG00000055632

Gene Name

hemicentin 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6502 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

31314415-31460738 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 31382478 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1323 (N1323K)

Ref Sequence

ENSEMBL: ENSMUSP00000109160 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113532] [ENSMUST00000226996]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000113532
AA Change: N1323K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000109160
Gene: ENSMUSG00000055632
AA Change: N1323K

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
VWA	37	211	1.21e-1	SMART
Blast:IG_like	263	340	2e-38	BLAST
IG	434	515	7.36e-2	SMART
IGc2	530	595	1.91e-9	SMART
IGc2	621	685	4.81e-15	SMART
IGc2	711	773	1.09e-13	SMART
IGc2	799	866	2.72e-14	SMART
IGc2	894	959	1.95e-15	SMART
IGc2	985	1049	5e-13	SMART
IGc2	1082	1147	1.09e-13	SMART
low complexity region	1151	1169	N/A	INTRINSIC
IGc2	1173	1232	7.07e-13	SMART
IGc2	1260	1326	4.31e-17	SMART
IGc2	1354	1428	3e-16	SMART
IGc2	1456	1522	1.82e-15	SMART
IGc2	1550	1615	2.7e-18	SMART
IGc2	1644	1708	1.3e-11	SMART
IGc2	1736	1801	6.69e-14	SMART
IG	1826	1917	2.31e0	SMART
IGc2	1932	1997	4.62e-17	SMART
IGc2	2024	2091	3.25e-12	SMART
IGc2	2117	2182	1.28e-10	SMART
IGc2	2209	2276	3.76e-8	SMART
IGc2	2305	2370	2.6e-11	SMART
IGc2	2399	2464	1.32e-12	SMART
IGc2	2492	2557	2.06e-14	SMART
IGc2	2588	2653	3.9e-15	SMART
IGc2	2686	2751	2.64e-12	SMART
IGc2	2797	2862	9.05e-11	SMART
IGc2	2892	2957	4.7e-9	SMART
IGc2	2984	3049	1.44e-13	SMART
IGc2	3079	3144	9.33e-13	SMART
IGc2	3171	3236	3.79e-13	SMART
IGc2	3264	3331	1.85e-16	SMART
IGc2	3360	3425	9.61e-15	SMART
low complexity region	3433	3445	N/A	INTRINSIC
IGc2	3453	3514	5.83e-14	SMART
IGc2	3542	3600	1.76e-8	SMART
low complexity region	3613	3627	N/A	INTRINSIC
IGc2	3628	3693	5.2e-11	SMART
IGc2	3719	3784	2.64e-12	SMART
IGc2	3810	3877	3.35e-5	SMART
IGc2	3903	3968	3.73e-12	SMART
IGc2	3994	4058	4.39e-9	SMART
IGc2	4084	4149	1.79e-14	SMART
low complexity region	4157	4169	N/A	INTRINSIC
IGc2	4175	4238	9.33e-13	SMART
IGc2	4265	4329	7.22e-19	SMART
IGc2	4355	4419	1.59e-15	SMART
Pfam:G2F	4431	4613	1.7e-56	PFAM
EGF_CA	4668	4708	5.78e-11	SMART
EGF_CA	4709	4753	9.39e-11	SMART
EGF_CA	4754	4796	7.69e-7	SMART
EGF_CA	4797	4837	2.19e-11	SMART
EGF_CA	4904	4943	6.74e-12	SMART
EGF_like	4944	4989	1.87e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000226996
AA Change: N1323K

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013D24Rik	A	T	6: 124,356,949	I24K	probably benign	Het
Adamts9	A	T	6: 92,872,335	C467S	probably damaging	Het
Adcy7	G	A	8: 88,325,479	R925Q	probably damaging	Het
Akap6	G	A	12: 53,140,215	G1471S	probably damaging	Het
Ap2b1	T	C	11: 83,342,679	V506A	probably damaging	Het
Apob	A	G	12: 8,001,814	I1113M	probably damaging	Het
Arsg	A	T	11: 109,517,336	N105Y	probably damaging	Het
Blm	T	A	7: 80,481,475	Y872F	probably damaging	Het
Btaf1	A	T	19: 36,983,617	N797Y	probably benign	Het
Camsap1	T	C	2: 25,956,308	E201G	probably damaging	Het
Ccdc122	T	A	14: 77,042,069		probably null	Homo
Ccdc141	A	G	2: 77,170,401	V29A	probably damaging	Het
Cd244	T	A	1: 171,577,879	D277E	probably benign	Het
Cfap157	T	C	2: 32,780,678	Y186C	probably damaging	Het
Ciita	C	T	16: 10,511,910	A686V	probably damaging	Het
Clptm1l	T	C	13: 73,617,765		probably null	Het
Col16a1	C	T	4: 130,055,994	P50L	probably damaging	Het
Crisp3	A	T	17: 40,235,913	V38D	probably damaging	Het
Cyfip2	T	C	11: 46,221,346	E1010G	probably damaging	Het
Dvl3	G	A	16: 20,527,383	E488K	probably damaging	Het
Eed	C	A	7: 89,977,029	E45D	probably benign	Het
Eln	A	G	5: 134,725,774		probably benign	Het
Fah	T	A	7: 84,594,835	I239F	probably damaging	Het
Fbxw5	T	A	2: 25,502,436	Y77N	possibly damaging	Het
Garnl3	T	C	2: 33,006,821	E602G	possibly damaging	Het
Gkn3	A	T	6: 87,388,804	M11K	probably benign	Het
Glt1d1	A	G	5: 127,706,981	Y333C	probably damaging	Het
Gm10762	A	T	2: 128,967,170	Y86*	probably null	Het
Gm14496	A	G	2: 182,000,593	M686V	probably benign	Het
Gse1	T	A	8: 120,553,689		probably null	Het
Herc4	C	A	10: 63,317,418	T1035K	probably benign	Het
Hnrnpd	T	A	5: 99,966,166	E3D	probably damaging	Het
Htr7	T	A	19: 35,969,610	I335F	probably damaging	Het
Itgae	A	T	11: 73,145,592	I1119F	probably benign	Het
Lcn11	T	C	2: 25,779,091	F137S	probably benign	Het
Lrp3	T	G	7: 35,203,988	D311A	possibly damaging	Het
Lrrc1	G	T	9: 77,442,191	D364E	probably damaging	Het
Lrrc37a	T	A	11: 103,492,179	E2456V	unknown	Het
Lrriq1	T	C	10: 103,227,184	Y87C	probably damaging	Het
Mcc	A	T	18: 44,468,390	L449*	probably null	Het
Mcc	A	T	18: 44,468,391	L624M	probably damaging	Het
Mcm9	T	C	10: 53,612,839	T496A	probably damaging	Het
Myef2	T	A	2: 125,116,682	D109V	probably damaging	Het
Myom3	C	T	4: 135,762,513		probably benign	Het
Nanos1	G	T	19: 60,756,539	G92W	possibly damaging	Het
Ncor1	T	A	11: 62,381,414	K84*	probably null	Het
Neb	T	A	2: 52,291,082	D1171V	probably benign	Het
Notch3	A	G	17: 32,158,217	W267R	probably damaging	Het
Olfr1167	A	T	2: 88,150,016	M1K	probably null	Het
Olfr26	A	C	9: 38,855,637	T192P	probably damaging	Het
Per2	A	G	1: 91,427,763	S758P	probably benign	Het
Pi4k2a	A	G	19: 42,090,932	Q144R	probably benign	Het
Pirb	A	T	7: 3,717,393	V327E	probably benign	Het
Pla2g4a	C	T	1: 149,872,616	W272*	probably null	Het
Plekha4	T	A	7: 45,530,576	M1K	probably null	Het
Ppt2	A	G	17: 34,625,920	C117R	probably damaging	Het
Prph	A	T	15: 99,056,386	I222F	probably damaging	Het
Rbm43	T	C	2: 51,925,576	D211G	probably damaging	Het
Rims2	A	G	15: 39,534,855	D1072G	probably benign	Het
Rnf123	G	T	9: 108,068,332	Q380K	possibly damaging	Het
Rnf145	T	C	11: 44,525,105	F49S	probably damaging	Het
Sall4	A	G	2: 168,755,708	I404T	probably damaging	Het
Slc25a39	G	A	11: 102,404,460	P228L	probably damaging	Het
Tbc1d14	T	C	5: 36,520,481	T377A	possibly damaging	Het
Tbc1d17	A	G	7: 44,841,625	I555T	probably benign	Het
Tmem131l	A	T	3: 83,922,408	S980T	probably damaging	Het
Tmem14a	G	T	1: 21,229,438	L97F	possibly damaging	Het
Tmem98	T	C	11: 80,812,635	V26A	probably benign	Het
Tmppe	G	T	9: 114,405,652	G340W	probably damaging	Het
Tsc1	T	C	2: 28,665,601	S237P	probably damaging	Het
Ttc30b	T	A	2: 75,937,104	N435I	possibly damaging	Het
Ubr4	C	T	4: 139,444,671	R2992W	probably damaging	Het
Ugt2a2	A	G	5: 87,460,459	V673A	possibly damaging	Het
Vmn2r19	T	C	6: 123,316,108	Y370H	possibly damaging	Het
Vmn2r20	A	G	6: 123,396,383	F500S	possibly damaging	Het
Zc3h7b	A	G	15: 81,769,051	Y47C	probably benign	Het
Zdhhc13	A	G	7: 48,815,560	E406G	possibly damaging	Het
Zfp418	T	C	7: 7,182,600	S521P	possibly damaging	Het

Other mutations in Hmcn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00965:Hmcn2	APN	2	31343096	missense	probably damaging	1.00
IGL00966:Hmcn2	APN	2	31428994	missense	probably damaging	0.97
IGL00973:Hmcn2	APN	2	31383821	intron	probably benign
IGL01364:Hmcn2	APN	2	31361814	nonsense	probably null
IGL01486:Hmcn2	APN	2	31336621	missense	probably damaging	1.00
IGL01530:Hmcn2	APN	2	31354264	missense	possibly damaging	0.85
IGL01550:Hmcn2	APN	2	31424252	missense	possibly damaging	0.84
IGL01710:Hmcn2	APN	2	31343102	missense	probably damaging	1.00
IGL01764:Hmcn2	APN	2	31405630	missense	possibly damaging	0.93
IGL01924:Hmcn2	APN	2	31398917	missense	probably benign	0.00
IGL02003:Hmcn2	APN	2	31428982	missense	possibly damaging	0.90
IGL02117:Hmcn2	APN	2	31457173	missense	possibly damaging	0.75
IGL02205:Hmcn2	APN	2	31400127	missense	probably damaging	1.00
IGL02273:Hmcn2	APN	2	31424377	missense	probably benign	0.06
IGL02313:Hmcn2	APN	2	31453605	missense	possibly damaging	0.68
IGL02326:Hmcn2	APN	2	31450952	missense	probably damaging	0.97
IGL02486:Hmcn2	APN	2	31420095	missense	probably damaging	0.98
IGL02551:Hmcn2	APN	2	31454811	missense	possibly damaging	0.83
IGL02695:Hmcn2	APN	2	31408973	missense	possibly damaging	0.87
IGL02725:Hmcn2	APN	2	31405528	missense	probably damaging	1.00
IGL02792:Hmcn2	APN	2	31346590	missense	probably damaging	1.00
IGL02882:Hmcn2	APN	2	31413367	nonsense	probably null
IGL03003:Hmcn2	APN	2	31433486	missense	probably damaging	0.98
IGL03067:Hmcn2	APN	2	31346630	missense	probably damaging	1.00
IGL03137:Hmcn2	APN	2	31362230	missense	probably damaging	0.98
IGL03220:Hmcn2	APN	2	31346621	missense	possibly damaging	0.94
IGL03411:Hmcn2	APN	2	31346637	missense	possibly damaging	0.83
PIT4544001:Hmcn2	UTSW	2	31428250	missense	probably damaging	0.98
R0044:Hmcn2	UTSW	2	31412508	missense	probably damaging	0.98
R0044:Hmcn2	UTSW	2	31412508	missense	probably damaging	0.98
R0048:Hmcn2	UTSW	2	31428237	missense	possibly damaging	0.92
R0048:Hmcn2	UTSW	2	31428237	missense	possibly damaging	0.92
R0078:Hmcn2	UTSW	2	31388344	missense	probably damaging	1.00
R0090:Hmcn2	UTSW	2	31426198	missense	probably damaging	1.00
R0173:Hmcn2	UTSW	2	31438331	critical splice donor site	probably null
R0257:Hmcn2	UTSW	2	31369164	splice site	probably benign
R0266:Hmcn2	UTSW	2	31394827	missense	probably benign	0.03
R0266:Hmcn2	UTSW	2	31445353	splice site	probably benign
R0326:Hmcn2	UTSW	2	31423225	nonsense	probably null
R0366:Hmcn2	UTSW	2	31424206	missense	possibly damaging	0.88
R0400:Hmcn2	UTSW	2	31400129	missense	probably damaging	0.98
R0412:Hmcn2	UTSW	2	31388247	missense	probably damaging	0.98
R0436:Hmcn2	UTSW	2	31405612	missense	probably damaging	1.00
R0457:Hmcn2	UTSW	2	31415284	critical splice donor site	probably null
R0487:Hmcn2	UTSW	2	31386677	missense	possibly damaging	0.60
R0568:Hmcn2	UTSW	2	31415236	missense	probably benign	0.02
R0755:Hmcn2	UTSW	2	31453160	missense	probably damaging	0.99
R0811:Hmcn2	UTSW	2	31420371	missense	probably damaging	0.99
R0812:Hmcn2	UTSW	2	31420371	missense	probably damaging	0.99
R0964:Hmcn2	UTSW	2	31391511	missense	probably benign	0.23
R0988:Hmcn2	UTSW	2	31335451	missense	probably damaging	1.00
R1484:Hmcn2	UTSW	2	31346495	missense	probably damaging	1.00
R1509:Hmcn2	UTSW	2	31314479	missense	possibly damaging	0.86
R1535:Hmcn2	UTSW	2	31420407	missense	possibly damaging	0.91
R1574:Hmcn2	UTSW	2	31404887	missense	probably damaging	0.97
R1574:Hmcn2	UTSW	2	31404887	missense	probably damaging	0.97
R1600:Hmcn2	UTSW	2	31430787	missense	probably damaging	0.98
R1623:Hmcn2	UTSW	2	31458039	missense	possibly damaging	0.84
R1692:Hmcn2	UTSW	2	31450844	missense	possibly damaging	0.47
R1719:Hmcn2	UTSW	2	31354721	missense	probably damaging	1.00
R1747:Hmcn2	UTSW	2	31457985	missense	probably benign	0.00
R1756:Hmcn2	UTSW	2	31396120	missense	probably damaging	0.99
R1763:Hmcn2	UTSW	2	31314590	missense	probably damaging	1.00
R1815:Hmcn2	UTSW	2	31393043	missense	probably damaging	0.97
R1822:Hmcn2	UTSW	2	31383692	missense	probably damaging	0.99
R1858:Hmcn2	UTSW	2	31415283	critical splice donor site	probably null
R1895:Hmcn2	UTSW	2	31405635	missense	probably damaging	0.99
R1908:Hmcn2	UTSW	2	31411910	critical splice donor site	probably null
R1946:Hmcn2	UTSW	2	31405635	missense	probably damaging	0.99
R1966:Hmcn2	UTSW	2	31389329	missense	probably damaging	0.99
R2007:Hmcn2	UTSW	2	31438255	missense	possibly damaging	0.91
R2050:Hmcn2	UTSW	2	31335436	missense	probably damaging	1.00
R2055:Hmcn2	UTSW	2	31378282	missense	probably benign	0.33
R2097:Hmcn2	UTSW	2	31380419	missense	probably damaging	1.00
R2145:Hmcn2	UTSW	2	31333931	splice site	probably benign
R2155:Hmcn2	UTSW	2	31460349	missense	possibly damaging	0.68
R2170:Hmcn2	UTSW	2	31380281	missense	probably benign	0.08
R2188:Hmcn2	UTSW	2	31419935	missense	probably benign	0.14
R2208:Hmcn2	UTSW	2	31380297	missense	probably damaging	1.00
R2217:Hmcn2	UTSW	2	31350574	missense	probably benign	0.02
R2407:Hmcn2	UTSW	2	31335412	critical splice acceptor site	probably null
R2764:Hmcn2	UTSW	2	31388298	missense	probably damaging	0.98
R2913:Hmcn2	UTSW	2	31460210	missense	possibly damaging	0.68
R2986:Hmcn2	UTSW	2	31360998	missense	probably damaging	1.00
R3157:Hmcn2	UTSW	2	31400255	missense	probably damaging	0.99
R3406:Hmcn2	UTSW	2	31433272	splice site	probably benign
R3429:Hmcn2	UTSW	2	31409144	missense	possibly damaging	0.87
R3737:Hmcn2	UTSW	2	31336612	nonsense	probably null
R3739:Hmcn2	UTSW	2	31336612	nonsense	probably null
R3771:Hmcn2	UTSW	2	31360896	missense	probably damaging	0.99
R3772:Hmcn2	UTSW	2	31360896	missense	probably damaging	0.99
R3773:Hmcn2	UTSW	2	31360896	missense	probably damaging	0.99
R3804:Hmcn2	UTSW	2	31352885	splice site	probably null
R3837:Hmcn2	UTSW	2	31413407	missense	probably damaging	0.99
R3838:Hmcn2	UTSW	2	31413407	missense	probably damaging	0.99
R3846:Hmcn2	UTSW	2	31430350	missense	possibly damaging	0.51
R3925:Hmcn2	UTSW	2	31453157	missense	probably benign	0.00
R3934:Hmcn2	UTSW	2	31380484	critical splice donor site	probably null
R3946:Hmcn2	UTSW	2	31382394	missense	possibly damaging	0.91
R4035:Hmcn2	UTSW	2	31336612	nonsense	probably null
R4057:Hmcn2	UTSW	2	31400238	missense	probably damaging	1.00
R4583:Hmcn2	UTSW	2	31413265	missense	possibly damaging	0.84
R4623:Hmcn2	UTSW	2	31396710	missense	probably damaging	1.00
R4647:Hmcn2	UTSW	2	31399019	missense	possibly damaging	0.82
R4668:Hmcn2	UTSW	2	31435792	missense	probably benign	0.40
R4669:Hmcn2	UTSW	2	31435792	missense	probably benign	0.40
R4687:Hmcn2	UTSW	2	31438285	missense	probably benign	0.14
R4735:Hmcn2	UTSW	2	31383775	missense	probably benign	0.06
R4772:Hmcn2	UTSW	2	31445314	missense	probably benign	0.02
R4866:Hmcn2	UTSW	2	31389391	missense	possibly damaging	0.88
R4916:Hmcn2	UTSW	2	31360980	missense	probably damaging	0.98
R4943:Hmcn2	UTSW	2	31335492	missense	probably damaging	1.00
R4967:Hmcn2	UTSW	2	31354164	critical splice acceptor site	probably null
R4973:Hmcn2	UTSW	2	31344096	missense	probably benign	0.15
R4975:Hmcn2	UTSW	2	31393025	missense	possibly damaging	0.88
R4994:Hmcn2	UTSW	2	31458055	critical splice donor site	probably null
R4997:Hmcn2	UTSW	2	31401708	missense	probably damaging	1.00
R5045:Hmcn2	UTSW	2	31409081	missense	probably damaging	1.00
R5117:Hmcn2	UTSW	2	31458049	missense	possibly damaging	0.95
R5151:Hmcn2	UTSW	2	31389443	missense	probably null
R5232:Hmcn2	UTSW	2	31457748	missense	probably damaging	0.99
R5237:Hmcn2	UTSW	2	31414716	missense	probably benign	0.01
R5288:Hmcn2	UTSW	2	31460321	missense	probably benign	0.11
R5375:Hmcn2	UTSW	2	31430441	missense	possibly damaging	0.92
R5379:Hmcn2	UTSW	2	31409011	missense	probably damaging	0.99
R5385:Hmcn2	UTSW	2	31460321	missense	probably benign	0.11
R5412:Hmcn2	UTSW	2	31346617	missense	possibly damaging	0.77
R5426:Hmcn2	UTSW	2	31336544	missense	possibly damaging	0.95
R5434:Hmcn2	UTSW	2	31420363	missense	probably damaging	1.00
R5441:Hmcn2	UTSW	2	31406416	missense	possibly damaging	0.82
R5484:Hmcn2	UTSW	2	31393054	nonsense	probably null
R5492:Hmcn2	UTSW	2	31420306	missense	probably benign	0.03
R5572:Hmcn2	UTSW	2	31414525	critical splice acceptor site	probably null
R5572:Hmcn2	UTSW	2	31414526	critical splice acceptor site	probably null
R5591:Hmcn2	UTSW	2	31344047	missense	probably damaging	1.00
R5614:Hmcn2	UTSW	2	31428303	missense	probably damaging	0.99
R5634:Hmcn2	UTSW	2	31333881	missense	probably damaging	1.00
R5645:Hmcn2	UTSW	2	31420812	missense	possibly damaging	0.92
R5716:Hmcn2	UTSW	2	31336567	missense	probably damaging	1.00
R5716:Hmcn2	UTSW	2	31458738	missense	possibly damaging	0.68
R5725:Hmcn2	UTSW	2	31383815	critical splice donor site	probably null
R5760:Hmcn2	UTSW	2	31414568	missense	possibly damaging	0.91
R5774:Hmcn2	UTSW	2	31409135	missense	possibly damaging	0.94
R5838:Hmcn2	UTSW	2	31457807	missense	probably damaging	0.99
R5899:Hmcn2	UTSW	2	31354673	missense	possibly damaging	0.93
R5916:Hmcn2	UTSW	2	31396139	missense	probably damaging	1.00
R5973:Hmcn2	UTSW	2	31420323	missense	probably damaging	0.99
R6002:Hmcn2	UTSW	2	31420309	missense	probably damaging	0.99
R6018:Hmcn2	UTSW	2	31370792	missense	probably benign	0.13
R6063:Hmcn2	UTSW	2	31434713	missense	probably benign	0.06
R6161:Hmcn2	UTSW	2	31356254	missense	probably benign
R6166:Hmcn2	UTSW	2	31369262	missense	probably damaging	1.00
R6177:Hmcn2	UTSW	2	31420106	nonsense	probably null
R6191:Hmcn2	UTSW	2	31458746	missense	probably damaging	0.99
R6195:Hmcn2	UTSW	2	31384115	missense	probably damaging	0.96
R6273:Hmcn2	UTSW	2	31411834	missense	probably damaging	0.99
R6293:Hmcn2	UTSW	2	31335451	missense	probably damaging	1.00
R6349:Hmcn2	UTSW	2	31388373	missense	probably damaging	1.00
R6395:Hmcn2	UTSW	2	31369257	missense	probably damaging	1.00
R6448:Hmcn2	UTSW	2	31420820	missense	probably benign	0.02
R6450:Hmcn2	UTSW	2	31361800	missense	probably benign	0.11
R6479:Hmcn2	UTSW	2	31425468	missense	probably damaging	0.99
R6511:Hmcn2	UTSW	2	31356342	missense	possibly damaging	0.79
R6537:Hmcn2	UTSW	2	31415268	missense	probably benign	0.00
R6880:Hmcn2	UTSW	2	31343056	missense	probably damaging	1.00
R6924:Hmcn2	UTSW	2	31350505	splice site	probably null
R6971:Hmcn2	UTSW	2	31432321	missense	probably benign	0.02
R7057:Hmcn2	UTSW	2	31422649	missense	probably damaging	0.99
R7141:Hmcn2	UTSW	2	31360896	missense	probably benign	0.17
R7268:Hmcn2	UTSW	2	31457966	missense	possibly damaging	0.48
R7307:Hmcn2	UTSW	2	31343081	missense	probably damaging	0.96
R7322:Hmcn2	UTSW	2	31459081	missense	probably damaging	0.99
R7334:Hmcn2	UTSW	2	31435794	missense	probably damaging	0.98
R7334:Hmcn2	UTSW	2	31453135	missense	possibly damaging	0.82
R7335:Hmcn2	UTSW	2	31392157	missense	possibly damaging	0.88
R7358:Hmcn2	UTSW	2	31416812	missense	probably damaging	1.00
R7359:Hmcn2	UTSW	2	31388383	missense	probably benign	0.13
R7488:Hmcn2	UTSW	2	31420830	missense	probably damaging	1.00
R7498:Hmcn2	UTSW	2	31383475	splice site	probably null
R7560:Hmcn2	UTSW	2	31457173	missense	probably benign
R7566:Hmcn2	UTSW	2	31454857	missense	probably damaging	0.96
R7570:Hmcn2	UTSW	2	31423911	missense	probably benign
R7574:Hmcn2	UTSW	2	31455519	missense	possibly damaging	0.68
R7599:Hmcn2	UTSW	2	31356286	missense	possibly damaging	0.93
R7654:Hmcn2	UTSW	2	31346569	missense	probably benign	0.00
R7662:Hmcn2	UTSW	2	31382345	missense	probably benign	0.01
R7666:Hmcn2	UTSW	2	31380233	missense	probably damaging	1.00
R7698:Hmcn2	UTSW	2	31423153	missense	probably damaging	0.98
R7722:Hmcn2	UTSW	2	31382500	nonsense	probably null
R7739:Hmcn2	UTSW	2	31458026	missense	possibly damaging	0.48
R7749:Hmcn2	UTSW	2	31453033	splice site	probably null
R7828:Hmcn2	UTSW	2	31405875	missense	possibly damaging	0.95
R7912:Hmcn2	UTSW	2	31420299	missense	probably benign	0.00
R7978:Hmcn2	UTSW	2	31389347	missense	probably benign	0.40
R8075:Hmcn2	UTSW	2	31389391	missense	possibly damaging	0.88
R8088:Hmcn2	UTSW	2	31426903	nonsense	probably null
R8101:Hmcn2	UTSW	2	31350070	missense	probably benign	0.08
R8124:Hmcn2	UTSW	2	31400124	missense	probably benign	0.01
R8145:Hmcn2	UTSW	2	31423105	missense	probably damaging	1.00
R8230:Hmcn2	UTSW	2	31344473	missense	possibly damaging	0.91
R8267:Hmcn2	UTSW	2	31459179	missense	probably benign
R8277:Hmcn2	UTSW	2	31369177	missense	probably benign	0.16
R8307:Hmcn2	UTSW	2	31396115	missense	probably damaging	0.99
R8353:Hmcn2	UTSW	2	31385341	splice site	probably null
R8415:Hmcn2	UTSW	2	31391076	missense	probably benign	0.15
R8416:Hmcn2	UTSW	2	31391076	missense	probably benign	0.15
R8437:Hmcn2	UTSW	2	31391076	missense	probably benign	0.15
R8438:Hmcn2	UTSW	2	31391076	missense	probably benign	0.15
R8440:Hmcn2	UTSW	2	31391076	missense	probably benign	0.15
R8442:Hmcn2	UTSW	2	31391076	missense	probably benign	0.15
R8497:Hmcn2	UTSW	2	31423345	missense	possibly damaging	0.92
R8520:Hmcn2	UTSW	2	31354714	missense	probably damaging	1.00
R8530:Hmcn2	UTSW	2	31391076	missense	probably benign	0.15
R8537:Hmcn2	UTSW	2	31391076	missense	probably benign	0.15
R8550:Hmcn2	UTSW	2	31350642	critical splice donor site	probably null
R8721:Hmcn2	UTSW	2	31425177	missense	probably damaging	1.00
R8795:Hmcn2	UTSW	2	31425381	missense	probably benign	0.01
R8802:Hmcn2	UTSW	2	31411276	missense	probably damaging	0.97
R8804:Hmcn2	UTSW	2	31425381	missense	probably benign	0.01
R8805:Hmcn2	UTSW	2	31425381	missense	probably benign	0.01
R8904:Hmcn2	UTSW	2	31433392	missense	possibly damaging	0.92
R8937:Hmcn2	UTSW	2	31314415	start codon destroyed	probably benign	0.01
R8947:Hmcn2	UTSW	2	31388208	missense	probably damaging	0.99
R8948:Hmcn2	UTSW	2	31354729	missense	probably damaging	1.00
R8950:Hmcn2	UTSW	2	31354729	missense	probably damaging	1.00
R8959:Hmcn2	UTSW	2	31392147	missense	probably damaging	1.00
R9025:Hmcn2	UTSW	2	31457955	missense	possibly damaging	0.56
R9039:Hmcn2	UTSW	2	31354634	missense	probably damaging	0.97
R9068:Hmcn2	UTSW	2	31413673	missense	probably benign	0.01
R9161:Hmcn2	UTSW	2	31352746	missense	probably benign	0.02
R9178:Hmcn2	UTSW	2	31391509	missense	possibly damaging	0.77
R9204:Hmcn2	UTSW	2	31388365	missense	probably damaging	0.98
R9317:Hmcn2	UTSW	2	31460316	missense	possibly damaging	0.91
R9341:Hmcn2	UTSW	2	31389347	missense	probably benign	0.40
R9343:Hmcn2	UTSW	2	31389347	missense	probably benign	0.40
R9355:Hmcn2	UTSW	2	31438290	missense	probably benign	0.18
R9371:Hmcn2	UTSW	2	31411905	missense	probably damaging	1.00
R9450:Hmcn2	UTSW	2	31426833	missense	probably damaging	1.00
R9477:Hmcn2	UTSW	2	31396019	critical splice acceptor site	probably null
R9483:Hmcn2	UTSW	2	31430363	missense
R9536:Hmcn2	UTSW	2	31445118	missense	possibly damaging	0.86
R9580:Hmcn2	UTSW	2	31404863	missense	probably benign	0.16
R9593:Hmcn2	UTSW	2	31354730	missense	probably damaging	0.99
R9649:Hmcn2	UTSW	2	31402438	missense	possibly damaging	0.95
R9706:Hmcn2	UTSW	2	31415267	missense	probably benign	0.00
X0066:Hmcn2	UTSW	2	31454811	missense	possibly damaging	0.83
X0067:Hmcn2	UTSW	2	31405867	missense	possibly damaging	0.82
Z1088:Hmcn2	UTSW	2	31459064	splice site	probably null
Z1088:Hmcn2	UTSW	2	31381067	missense	probably benign	0.01
Z1176:Hmcn2	UTSW	2	31344029	missense	possibly damaging	0.95
Z1176:Hmcn2	UTSW	2	31425416	missense	probably damaging	1.00
Z1176:Hmcn2	UTSW	2	31429091	missense	probably damaging	0.97
Z1177:Hmcn2	UTSW	2	31344506	missense	probably damaging	1.00
Z1177:Hmcn2	UTSW	2	31426824	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATGATTCTACATACCCTGCCAGG -3'
(R):5'- TACCTGGCAAAATGGGGTG -3'

Sequencing Primer
(F):5'- TGCCAGGGACTCCAAAGC -3'
(R):5'- TCTCTTGGGGAGAAGGAATCAG -3'

Posted On

2018-06-06