Incidental Mutation 'R6502:Tbc1d14'
ID519779
Institutional Source Beutler Lab
Gene Symbol Tbc1d14
Ensembl Gene ENSMUSG00000029192
Gene NameTBC1 domain family, member 14
Synonyms2810413P16Rik, D5Ertd110e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6502 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location36490604-36593276 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36520481 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 377 (T377A)
Ref Sequence ENSEMBL: ENSMUSP00000115467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031094] [ENSMUST00000124036] [ENSMUST00000126077] [ENSMUST00000130417] [ENSMUST00000136189] [ENSMUST00000140607] [ENSMUST00000141017] [ENSMUST00000146430] [ENSMUST00000150813] [ENSMUST00000171385]
Predicted Effect probably benign
Transcript: ENSMUST00000031094
AA Change: T377A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000031094
Gene: ENSMUSG00000029192
AA Change: T377A

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 316 375 1e-8 BLAST
TBC 399 635 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124036
AA Change: T397A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000117414
Gene: ENSMUSG00000029192
AA Change: T397A

DomainStartEndE-ValueType
low complexity region 179 194 N/A INTRINSIC
Blast:TBC 336 395 1e-8 BLAST
TBC 419 655 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126077
AA Change: T96A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000114508
Gene: ENSMUSG00000029192
AA Change: T96A

DomainStartEndE-ValueType
Blast:TBC 35 94 5e-9 BLAST
TBC 118 354 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130417
AA Change: T397A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000116519
Gene: ENSMUSG00000029192
AA Change: T397A

DomainStartEndE-ValueType
low complexity region 179 194 N/A INTRINSIC
Blast:TBC 336 395 1e-8 BLAST
TBC 419 655 1.49e-54 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000136189
AA Change: T377A

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115467
Gene: ENSMUSG00000029192
AA Change: T377A

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 247 322 1e-32 BLAST
TBC 399 559 8.9e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140607
AA Change: T377A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000121516
Gene: ENSMUSG00000029192
AA Change: T377A

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 316 375 1e-8 BLAST
TBC 399 635 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141626
Predicted Effect probably benign
Transcript: ENSMUST00000146430
AA Change: T377A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000121816
Gene: ENSMUSG00000029192
AA Change: T377A

DomainStartEndE-ValueType
low complexity region 159 174 N/A INTRINSIC
Blast:TBC 316 375 1e-8 BLAST
TBC 399 635 1.49e-54 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149157
Predicted Effect probably benign
Transcript: ENSMUST00000150813
AA Change: T96A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115926
Gene: ENSMUSG00000029192
AA Change: T96A

DomainStartEndE-ValueType
Blast:TBC 35 94 3e-9 BLAST
TBC 118 305 1.08e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171385
AA Change: T96A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000131876
Gene: ENSMUSG00000029192
AA Change: T96A

DomainStartEndE-ValueType
Blast:TBC 35 94 5e-9 BLAST
TBC 118 354 1.49e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173532
SMART Domains Protein: ENSMUSP00000133477
Gene: ENSMUSG00000029192

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
Pfam:RabGAP-TBC 59 129 6.8e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for an ENU-induced mutation appear arrested at an egg cylinder-like state and show complete embryonic lethality between implantation and placentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,356,949 I24K probably benign Het
Adamts9 A T 6: 92,872,335 C467S probably damaging Het
Adcy7 G A 8: 88,325,479 R925Q probably damaging Het
Akap6 G A 12: 53,140,215 G1471S probably damaging Het
Ap2b1 T C 11: 83,342,679 V506A probably damaging Het
Apob A G 12: 8,001,814 I1113M probably damaging Het
Arsg A T 11: 109,517,336 N105Y probably damaging Het
Blm T A 7: 80,481,475 Y872F probably damaging Het
Btaf1 A T 19: 36,983,617 N797Y probably benign Het
Camsap1 T C 2: 25,956,308 E201G probably damaging Het
Ccdc122 T A 14: 77,042,069 probably null Homo
Ccdc141 A G 2: 77,170,401 V29A probably damaging Het
Cd244 T A 1: 171,577,879 D277E probably benign Het
Cfap157 T C 2: 32,780,678 Y186C probably damaging Het
Ciita C T 16: 10,511,910 A686V probably damaging Het
Clptm1l T C 13: 73,617,765 probably null Het
Col16a1 C T 4: 130,055,994 P50L probably damaging Het
Crisp3 A T 17: 40,235,913 V38D probably damaging Het
Cyfip2 T C 11: 46,221,346 E1010G probably damaging Het
Dvl3 G A 16: 20,527,383 E488K probably damaging Het
Eed C A 7: 89,977,029 E45D probably benign Het
Eln A G 5: 134,725,774 probably benign Het
Fah T A 7: 84,594,835 I239F probably damaging Het
Fbxw5 T A 2: 25,502,436 Y77N possibly damaging Het
Garnl3 T C 2: 33,006,821 E602G possibly damaging Het
Gkn3 A T 6: 87,388,804 M11K probably benign Het
Glt1d1 A G 5: 127,706,981 Y333C probably damaging Het
Gm10762 A T 2: 128,967,170 Y86* probably null Het
Gm14496 A G 2: 182,000,593 M686V probably benign Het
Gse1 T A 8: 120,553,689 probably null Het
Herc4 C A 10: 63,317,418 T1035K probably benign Het
Hmcn2 T A 2: 31,382,478 N1323K probably damaging Het
Hnrnpd T A 5: 99,966,166 E3D probably damaging Het
Htr7 T A 19: 35,969,610 I335F probably damaging Het
Itgae A T 11: 73,145,592 I1119F probably benign Het
Lcn11 T C 2: 25,779,091 F137S probably benign Het
Lrp3 T G 7: 35,203,988 D311A possibly damaging Het
Lrrc1 G T 9: 77,442,191 D364E probably damaging Het
Lrrc37a T A 11: 103,492,179 E2456V unknown Het
Lrriq1 T C 10: 103,227,184 Y87C probably damaging Het
Mcc A T 18: 44,468,390 L449* probably null Het
Mcc A T 18: 44,468,391 L624M probably damaging Het
Mcm9 T C 10: 53,612,839 T496A probably damaging Het
Myef2 T A 2: 125,116,682 D109V probably damaging Het
Myom3 C T 4: 135,762,513 probably benign Het
Nanos1 G T 19: 60,756,539 G92W possibly damaging Het
Ncor1 T A 11: 62,381,414 K84* probably null Het
Neb T A 2: 52,291,082 D1171V probably benign Het
Notch3 A G 17: 32,158,217 W267R probably damaging Het
Olfr1167 A T 2: 88,150,016 M1K probably null Het
Olfr26 A C 9: 38,855,637 T192P probably damaging Het
Per2 A G 1: 91,427,763 S758P probably benign Het
Pi4k2a A G 19: 42,090,932 Q144R probably benign Het
Pirb A T 7: 3,717,393 V327E probably benign Het
Pla2g4a C T 1: 149,872,616 W272* probably null Het
Plekha4 T A 7: 45,530,576 M1K probably null Het
Ppt2 A G 17: 34,625,920 C117R probably damaging Het
Prph A T 15: 99,056,386 I222F probably damaging Het
Rbm43 T C 2: 51,925,576 D211G probably damaging Het
Rims2 A G 15: 39,534,855 D1072G probably benign Het
Rnf123 G T 9: 108,068,332 Q380K possibly damaging Het
Rnf145 T C 11: 44,525,105 F49S probably damaging Het
Sall4 A G 2: 168,755,708 I404T probably damaging Het
Slc25a39 G A 11: 102,404,460 P228L probably damaging Het
Tbc1d17 A G 7: 44,841,625 I555T probably benign Het
Tmem131l A T 3: 83,922,408 S980T probably damaging Het
Tmem14a G T 1: 21,229,438 L97F possibly damaging Het
Tmem98 T C 11: 80,812,635 V26A probably benign Het
Tmppe G T 9: 114,405,652 G340W probably damaging Het
Tsc1 T C 2: 28,665,601 S237P probably damaging Het
Ttc30b T A 2: 75,937,104 N435I possibly damaging Het
Ubr4 C T 4: 139,444,671 R2992W probably damaging Het
Ugt2a2 A G 5: 87,460,459 V673A possibly damaging Het
Vmn2r19 T C 6: 123,316,108 Y370H possibly damaging Het
Vmn2r20 A G 6: 123,396,383 F500S possibly damaging Het
Zc3h7b A G 15: 81,769,051 Y47C probably benign Het
Zdhhc13 A G 7: 48,815,560 E406G possibly damaging Het
Zfp418 T C 7: 7,182,600 S521P possibly damaging Het
Other mutations in Tbc1d14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Tbc1d14 APN 5 36543200 nonsense probably null
IGL01759:Tbc1d14 APN 5 36571569 missense probably damaging 1.00
IGL01939:Tbc1d14 APN 5 36508437 unclassified probably benign
IGL01977:Tbc1d14 APN 5 36505037 missense probably damaging 1.00
IGL02064:Tbc1d14 APN 5 36507675 nonsense probably null
IGL02250:Tbc1d14 APN 5 36571519 missense probably damaging 1.00
IGL02370:Tbc1d14 APN 5 36495218 missense possibly damaging 0.68
IGL03088:Tbc1d14 APN 5 36524964 missense probably damaging 1.00
R0408:Tbc1d14 UTSW 5 36571299 missense possibly damaging 0.83
R1863:Tbc1d14 UTSW 5 36507693 missense probably damaging 1.00
R2007:Tbc1d14 UTSW 5 36571374 missense possibly damaging 0.78
R2064:Tbc1d14 UTSW 5 36522930 nonsense probably null
R2266:Tbc1d14 UTSW 5 36543217 missense possibly damaging 0.52
R2267:Tbc1d14 UTSW 5 36543217 missense possibly damaging 0.52
R2268:Tbc1d14 UTSW 5 36543217 missense possibly damaging 0.52
R2269:Tbc1d14 UTSW 5 36543217 missense possibly damaging 0.52
R3955:Tbc1d14 UTSW 5 36543215 nonsense probably null
R4222:Tbc1d14 UTSW 5 36493108 missense probably benign
R4618:Tbc1d14 UTSW 5 36530381 intron probably benign
R4780:Tbc1d14 UTSW 5 36571256 intron probably benign
R4817:Tbc1d14 UTSW 5 36571831 missense probably damaging 1.00
R5315:Tbc1d14 UTSW 5 36507588 missense probably damaging 0.99
R5521:Tbc1d14 UTSW 5 36520552 missense probably damaging 0.99
R5590:Tbc1d14 UTSW 5 36525045 missense probably damaging 1.00
R6190:Tbc1d14 UTSW 5 36571884 missense possibly damaging 0.58
R6748:Tbc1d14 UTSW 5 36495254 missense probably damaging 0.96
R7089:Tbc1d14 UTSW 5 36512540 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCTTTACAAACATGGCTCAGG -3'
(R):5'- ACATGCACTCAGGCTAGAGG -3'

Sequencing Primer
(F):5'- GCTCAGGCCCTCAAAATATAAACTGG -3'
(R):5'- TCATACTCAGCCTTTACGGGGG -3'
Posted On2018-06-06