Incidental Mutation 'R6502:Fah'
ID 519796
Institutional Source Beutler Lab
Gene Symbol Fah
Ensembl Gene ENSMUSG00000030630
Gene Name fumarylacetoacetate hydrolase
Synonyms swst
MMRRC Submission 044634-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6502 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 84234367-84255150 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84244043 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 239 (I239F)
Ref Sequence ENSEMBL: ENSMUSP00000032865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032865] [ENSMUST00000128460]
AlphaFold P35505
PDB Structure CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE COMPLEXED WITH 4-(HYDROXYMETHYLPHOSPHINOYL)-3-OXO-BUTANOIC ACID [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE COMPLEXED WITH FUMARATE AND ACETOACETATE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE FUMARYLACETOACETATE HYDROLASE REFINED AT 1.55 ANGSTROM RESOLUTION [X-RAY DIFFRACTION]
Mouse fumarylacetoacetate hydrolase complexes with a transition-state mimic of the complete substrate [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000032865
AA Change: I239F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032865
Gene: ENSMUSG00000030630
AA Change: I239F

DomainStartEndE-ValueType
Pfam:FAA_hydrolase_N 15 118 1.7e-36 PFAM
Pfam:FAA_hydrolase 123 413 1e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128460
SMART Domains Protein: ENSMUSP00000121439
Gene: ENSMUSG00000030630

DomainStartEndE-ValueType
Pfam:FAA_hydrolase_N 1 48 7.2e-10 PFAM
Pfam:FAA_hydrolase 53 140 7.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209112
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted, deletion, and ENU-induced mutations die perinatally with liver and kidney dysfunction, hypoglycemia, and grossly altered liver mRNA expression. Mice homozygous for a mutation of this gene exhibit inappropriate bouts of activity during the light period of the circadian cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,333,908 (GRCm39) I24K probably benign Het
Adamts9 A T 6: 92,849,316 (GRCm39) C467S probably damaging Het
Adcy7 G A 8: 89,052,107 (GRCm39) R925Q probably damaging Het
Akap6 G A 12: 53,186,998 (GRCm39) G1471S probably damaging Het
Ap2b1 T C 11: 83,233,505 (GRCm39) V506A probably damaging Het
Apob A G 12: 8,051,814 (GRCm39) I1113M probably damaging Het
Arsg A T 11: 109,408,162 (GRCm39) N105Y probably damaging Het
Blm T A 7: 80,131,223 (GRCm39) Y872F probably damaging Het
Btaf1 A T 19: 36,961,017 (GRCm39) N797Y probably benign Het
Camsap1 T C 2: 25,846,320 (GRCm39) E201G probably damaging Het
Ccdc122 T A 14: 77,279,509 (GRCm39) probably null Homo
Ccdc141 A G 2: 77,000,745 (GRCm39) V29A probably damaging Het
Cd244a T A 1: 171,405,447 (GRCm39) D277E probably benign Het
Cfap157 T C 2: 32,670,690 (GRCm39) Y186C probably damaging Het
Ciita C T 16: 10,329,774 (GRCm39) A686V probably damaging Het
Clptm1l T C 13: 73,765,884 (GRCm39) probably null Het
Col16a1 C T 4: 129,949,787 (GRCm39) P50L probably damaging Het
Crisp3 A T 17: 40,546,804 (GRCm39) V38D probably damaging Het
Cyfip2 T C 11: 46,112,173 (GRCm39) E1010G probably damaging Het
Dvl3 G A 16: 20,346,133 (GRCm39) E488K probably damaging Het
Eed C A 7: 89,626,237 (GRCm39) E45D probably benign Het
Eln A G 5: 134,754,628 (GRCm39) probably benign Het
Fbxw5 T A 2: 25,392,448 (GRCm39) Y77N possibly damaging Het
Garnl3 T C 2: 32,896,833 (GRCm39) E602G possibly damaging Het
Gkn3 A T 6: 87,365,786 (GRCm39) M11K probably benign Het
Glt1d1 A G 5: 127,784,045 (GRCm39) Y333C probably damaging Het
Gm10762 A T 2: 128,809,090 (GRCm39) Y86* probably null Het
Gm14496 A G 2: 181,642,386 (GRCm39) M686V probably benign Het
Gse1 T A 8: 121,280,428 (GRCm39) probably null Het
Herc4 C A 10: 63,153,197 (GRCm39) T1035K probably benign Het
Hmcn2 T A 2: 31,272,490 (GRCm39) N1323K probably damaging Het
Hnrnpd T A 5: 100,114,025 (GRCm39) E3D probably damaging Het
Htr7 T A 19: 35,947,010 (GRCm39) I335F probably damaging Het
Ift70b T A 2: 75,767,448 (GRCm39) N435I possibly damaging Het
Itgae A T 11: 73,036,418 (GRCm39) I1119F probably benign Het
Lcn11 T C 2: 25,669,103 (GRCm39) F137S probably benign Het
Lrp3 T G 7: 34,903,413 (GRCm39) D311A possibly damaging Het
Lrrc1 G T 9: 77,349,473 (GRCm39) D364E probably damaging Het
Lrrc37a T A 11: 103,383,005 (GRCm39) E2456V unknown Het
Lrriq1 T C 10: 103,063,045 (GRCm39) Y87C probably damaging Het
Mcc A T 18: 44,601,457 (GRCm39) L449* probably null Het
Mcc A T 18: 44,601,458 (GRCm39) L624M probably damaging Het
Mcm9 T C 10: 53,488,935 (GRCm39) T496A probably damaging Het
Myef2 T A 2: 124,958,602 (GRCm39) D109V probably damaging Het
Myom3 C T 4: 135,489,824 (GRCm39) probably benign Het
Nanos1 G T 19: 60,744,977 (GRCm39) G92W possibly damaging Het
Ncor1 T A 11: 62,272,240 (GRCm39) K84* probably null Het
Neb T A 2: 52,181,094 (GRCm39) D1171V probably benign Het
Notch3 A G 17: 32,377,191 (GRCm39) W267R probably damaging Het
Or5d39 A T 2: 87,980,360 (GRCm39) M1K probably null Het
Or8d1 A C 9: 38,766,933 (GRCm39) T192P probably damaging Het
Per2 A G 1: 91,355,485 (GRCm39) S758P probably benign Het
Pi4k2a A G 19: 42,079,371 (GRCm39) Q144R probably benign Het
Pirb A T 7: 3,720,392 (GRCm39) V327E probably benign Het
Pla2g4a C T 1: 149,748,367 (GRCm39) W272* probably null Het
Plekha4 T A 7: 45,180,000 (GRCm39) M1K probably null Het
Ppt2 A G 17: 34,844,894 (GRCm39) C117R probably damaging Het
Prph A T 15: 98,954,267 (GRCm39) I222F probably damaging Het
Rbm43 T C 2: 51,815,588 (GRCm39) D211G probably damaging Het
Rims2 A G 15: 39,398,251 (GRCm39) D1072G probably benign Het
Rnf123 G T 9: 107,945,531 (GRCm39) Q380K possibly damaging Het
Rnf145 T C 11: 44,415,932 (GRCm39) F49S probably damaging Het
Sall4 A G 2: 168,597,628 (GRCm39) I404T probably damaging Het
Slc25a39 G A 11: 102,295,286 (GRCm39) P228L probably damaging Het
Tbc1d14 T C 5: 36,677,825 (GRCm39) T377A possibly damaging Het
Tbc1d17 A G 7: 44,491,049 (GRCm39) I555T probably benign Het
Tmem131l A T 3: 83,829,715 (GRCm39) S980T probably damaging Het
Tmem14a G T 1: 21,299,662 (GRCm39) L97F possibly damaging Het
Tmem98 T C 11: 80,703,461 (GRCm39) V26A probably benign Het
Tmppe G T 9: 114,234,720 (GRCm39) G340W probably damaging Het
Tsc1 T C 2: 28,555,613 (GRCm39) S237P probably damaging Het
Ubr4 C T 4: 139,171,982 (GRCm39) R2992W probably damaging Het
Ugt2a2 A G 5: 87,608,318 (GRCm39) V673A possibly damaging Het
Vmn2r19 T C 6: 123,293,067 (GRCm39) Y370H possibly damaging Het
Vmn2r20 A G 6: 123,373,342 (GRCm39) F500S possibly damaging Het
Zc3h7b A G 15: 81,653,252 (GRCm39) Y47C probably benign Het
Zdhhc13 A G 7: 48,465,308 (GRCm39) E406G possibly damaging Het
Zfp418 T C 7: 7,185,599 (GRCm39) S521P possibly damaging Het
Other mutations in Fah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01798:Fah APN 7 84,238,837 (GRCm39) missense probably benign 0.33
IGL02374:Fah APN 7 84,254,909 (GRCm39) missense probably benign 0.02
IGL02975:Fah APN 7 84,250,287 (GRCm39) missense probably benign 0.00
IGL03403:Fah APN 7 84,242,417 (GRCm39) missense probably damaging 1.00
R0245:Fah UTSW 7 84,244,706 (GRCm39) missense probably benign
R0689:Fah UTSW 7 84,242,392 (GRCm39) critical splice donor site probably null
R1173:Fah UTSW 7 84,250,344 (GRCm39) start codon destroyed probably null 1.00
R1413:Fah UTSW 7 84,242,420 (GRCm39) missense probably damaging 0.99
R1995:Fah UTSW 7 84,251,389 (GRCm39) missense probably damaging 1.00
R2150:Fah UTSW 7 84,244,042 (GRCm39) missense probably damaging 1.00
R3612:Fah UTSW 7 84,234,498 (GRCm39) missense probably damaging 0.98
R3620:Fah UTSW 7 84,238,159 (GRCm39) splice site probably null
R4360:Fah UTSW 7 84,238,856 (GRCm39) missense probably damaging 1.00
R4386:Fah UTSW 7 84,248,344 (GRCm39) missense probably damaging 1.00
R4923:Fah UTSW 7 84,251,260 (GRCm39) intron probably benign
R5151:Fah UTSW 7 84,250,259 (GRCm39) missense possibly damaging 0.87
R5443:Fah UTSW 7 84,241,604 (GRCm39) missense probably damaging 0.96
R5470:Fah UTSW 7 84,242,393 (GRCm39) critical splice donor site probably null
R5976:Fah UTSW 7 84,243,949 (GRCm39) missense probably benign 0.00
R6086:Fah UTSW 7 84,238,120 (GRCm39) missense probably damaging 1.00
R6272:Fah UTSW 7 84,244,753 (GRCm39) missense probably damaging 1.00
R6586:Fah UTSW 7 84,242,468 (GRCm39) missense probably benign 0.04
R7522:Fah UTSW 7 84,246,282 (GRCm39) missense probably benign 0.00
R7832:Fah UTSW 7 84,244,686 (GRCm39) missense probably damaging 1.00
R8535:Fah UTSW 7 84,250,305 (GRCm39) missense probably benign
R8823:Fah UTSW 7 84,254,925 (GRCm39) missense possibly damaging 0.85
RF002:Fah UTSW 7 84,238,836 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATCACCATGTCTCAGTATCAG -3'
(R):5'- ATTGTTCCCTAGCACAGCACC -3'

Sequencing Primer
(F):5'- ACCATGTCTCAGTATCAGAGGGC -3'
(R):5'- GCACCTCCAAGGACCTCTGTC -3'
Posted On 2018-06-06