Incidental Mutation 'R6502:Eed'
List |< first << previous [record 21 of 79] next >> last >|
ID519797
Institutional Source Beutler Lab
Gene Symbol Eed
Ensembl Gene ENSMUSG00000030619
Gene Nameembryonic ectoderm development
Synonymsl7Rn5, l(7)5Rn
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R6502 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location89954654-89980983 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 89977029 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 45 (E45D)
Ref Sequence ENSEMBL: ENSMUSP00000102853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107234] [ENSMUST00000208977]
PDB Structure
Structural basis of EZH2 recognition by EED [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000107234
AA Change: E45D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102853
Gene: ENSMUSG00000030619
AA Change: E45D

DomainStartEndE-ValueType
WD40 81 125 1.43e1 SMART
WD40 131 176 2.04e2 SMART
WD40 179 219 1.3e-7 SMART
WD40 222 264 1.61e-3 SMART
WD40 295 332 7.1e1 SMART
Blast:WD40 349 390 1e-17 BLAST
WD40 397 438 4.3e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208643
Predicted Effect probably benign
Transcript: ENSMUST00000208977
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein interacts with enhancer of zeste 2, the cytoplasmic tail of integrin beta7, immunodeficiency virus type 1 (HIV-1) MA protein, and histone deacetylase proteins. This protein mediates repression of gene activity through histone deacetylation, and may act as a specific regulator of integrin function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are dwarfed and their coat color is dilute. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,356,949 I24K probably benign Het
Adamts9 A T 6: 92,872,335 C467S probably damaging Het
Adcy7 G A 8: 88,325,479 R925Q probably damaging Het
Akap6 G A 12: 53,140,215 G1471S probably damaging Het
Ap2b1 T C 11: 83,342,679 V506A probably damaging Het
Apob A G 12: 8,001,814 I1113M probably damaging Het
Arsg A T 11: 109,517,336 N105Y probably damaging Het
Blm T A 7: 80,481,475 Y872F probably damaging Het
Btaf1 A T 19: 36,983,617 N797Y probably benign Het
Camsap1 T C 2: 25,956,308 E201G probably damaging Het
Ccdc122 T A 14: 77,042,069 probably null Homo
Ccdc141 A G 2: 77,170,401 V29A probably damaging Het
Cd244 T A 1: 171,577,879 D277E probably benign Het
Cfap157 T C 2: 32,780,678 Y186C probably damaging Het
Ciita C T 16: 10,511,910 A686V probably damaging Het
Clptm1l T C 13: 73,617,765 probably null Het
Col16a1 C T 4: 130,055,994 P50L probably damaging Het
Crisp3 A T 17: 40,235,913 V38D probably damaging Het
Cyfip2 T C 11: 46,221,346 E1010G probably damaging Het
Dvl3 G A 16: 20,527,383 E488K probably damaging Het
Eln A G 5: 134,725,774 probably benign Het
Fah T A 7: 84,594,835 I239F probably damaging Het
Fbxw5 T A 2: 25,502,436 Y77N possibly damaging Het
Garnl3 T C 2: 33,006,821 E602G possibly damaging Het
Gkn3 A T 6: 87,388,804 M11K probably benign Het
Glt1d1 A G 5: 127,706,981 Y333C probably damaging Het
Gm10762 A T 2: 128,967,170 Y86* probably null Het
Gm14496 A G 2: 182,000,593 M686V probably benign Het
Gse1 T A 8: 120,553,689 probably null Het
Herc4 C A 10: 63,317,418 T1035K probably benign Het
Hmcn2 T A 2: 31,382,478 N1323K probably damaging Het
Hnrnpd T A 5: 99,966,166 E3D probably damaging Het
Htr7 T A 19: 35,969,610 I335F probably damaging Het
Itgae A T 11: 73,145,592 I1119F probably benign Het
Lcn11 T C 2: 25,779,091 F137S probably benign Het
Lrp3 T G 7: 35,203,988 D311A possibly damaging Het
Lrrc1 G T 9: 77,442,191 D364E probably damaging Het
Lrrc37a T A 11: 103,492,179 E2456V unknown Het
Lrriq1 T C 10: 103,227,184 Y87C probably damaging Het
Mcc A T 18: 44,468,390 L449* probably null Het
Mcc A T 18: 44,468,391 L624M probably damaging Het
Mcm9 T C 10: 53,612,839 T496A probably damaging Het
Myef2 T A 2: 125,116,682 D109V probably damaging Het
Myom3 C T 4: 135,762,513 probably benign Het
Nanos1 G T 19: 60,756,539 G92W possibly damaging Het
Ncor1 T A 11: 62,381,414 K84* probably null Het
Neb T A 2: 52,291,082 D1171V probably benign Het
Notch3 A G 17: 32,158,217 W267R probably damaging Het
Olfr1167 A T 2: 88,150,016 M1K probably null Het
Olfr26 A C 9: 38,855,637 T192P probably damaging Het
Per2 A G 1: 91,427,763 S758P probably benign Het
Pi4k2a A G 19: 42,090,932 Q144R probably benign Het
Pirb A T 7: 3,717,393 V327E probably benign Het
Pla2g4a C T 1: 149,872,616 W272* probably null Het
Plekha4 T A 7: 45,530,576 M1K probably null Het
Ppt2 A G 17: 34,625,920 C117R probably damaging Het
Prph A T 15: 99,056,386 I222F probably damaging Het
Rbm43 T C 2: 51,925,576 D211G probably damaging Het
Rims2 A G 15: 39,534,855 D1072G probably benign Het
Rnf123 G T 9: 108,068,332 Q380K possibly damaging Het
Rnf145 T C 11: 44,525,105 F49S probably damaging Het
Sall4 A G 2: 168,755,708 I404T probably damaging Het
Slc25a39 G A 11: 102,404,460 P228L probably damaging Het
Tbc1d14 T C 5: 36,520,481 T377A possibly damaging Het
Tbc1d17 A G 7: 44,841,625 I555T probably benign Het
Tmem131l A T 3: 83,922,408 S980T probably damaging Het
Tmem14a G T 1: 21,229,438 L97F possibly damaging Het
Tmem98 T C 11: 80,812,635 V26A probably benign Het
Tmppe G T 9: 114,405,652 G340W probably damaging Het
Tsc1 T C 2: 28,665,601 S237P probably damaging Het
Ttc30b T A 2: 75,937,104 N435I possibly damaging Het
Ubr4 C T 4: 139,444,671 R2992W probably damaging Het
Ugt2a2 A G 5: 87,460,459 V673A possibly damaging Het
Vmn2r19 T C 6: 123,316,108 Y370H possibly damaging Het
Vmn2r20 A G 6: 123,396,383 F500S possibly damaging Het
Zc3h7b A G 15: 81,769,051 Y47C probably benign Het
Zdhhc13 A G 7: 48,815,560 E406G possibly damaging Het
Zfp418 T C 7: 7,182,600 S521P possibly damaging Het
Other mutations in Eed
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Eed APN 7 89969595 missense possibly damaging 0.71
IGL02232:Eed APN 7 89972285 missense probably damaging 1.00
IGL02740:Eed APN 7 89972256 missense possibly damaging 0.91
R0417:Eed UTSW 7 89971552 nonsense probably null
R1018:Eed UTSW 7 89967811 splice site probably benign
R1581:Eed UTSW 7 89980468 missense possibly damaging 0.53
R3959:Eed UTSW 7 89954941 missense probably benign 0.10
R4774:Eed UTSW 7 89964768 missense probably damaging 1.00
R5021:Eed UTSW 7 89972305 missense probably damaging 0.98
R5238:Eed UTSW 7 89976965 missense probably benign
R5561:Eed UTSW 7 89967793 missense probably damaging 1.00
R5959:Eed UTSW 7 89969627 missense probably damaging 1.00
R6223:Eed UTSW 7 89956287 missense probably damaging 1.00
R6391:Eed UTSW 7 89976941 missense probably benign 0.00
R7021:Eed UTSW 7 89980519 missense possibly damaging 0.53
R7054:Eed UTSW 7 89964727 critical splice donor site probably null
R7056:Eed UTSW 7 89970356 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TGCCCTGAGAGAAGTCTGAAG -3'
(R):5'- CTGCTCAATCCGGTCCAAAG -3'

Sequencing Primer
(F):5'- AGTCTGAAGTCTAGAGCTTCCAGC -3'
(R):5'- AGTACACTGTAGCTGTCTTCAGAC -3'
Posted On2018-06-06