Incidental Mutation 'R6502:Rnf123'
ID 519802
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock # R6502 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 108051534-108083346 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 108068332 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 380 (Q380K)
Ref Sequence ENSEMBL: ENSMUSP00000136953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000161828] [ENSMUST00000162355] [ENSMUST00000162516] [ENSMUST00000174504] [ENSMUST00000178267]
AlphaFold Q5XPI3
Predicted Effect possibly damaging
Transcript: ENSMUST00000047746
AA Change: Q380K

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: Q380K

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159136
Predicted Effect possibly damaging
Transcript: ENSMUST00000160249
AA Change: Q380K

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: Q380K

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
AA Change: Q380K

PolyPhen 2 Score 0.121 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: Q380K

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect probably benign
Transcript: ENSMUST00000161828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162152
Predicted Effect possibly damaging
Transcript: ENSMUST00000162355
AA Change: Q380K

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: Q380K

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162516
Predicted Effect probably benign
Transcript: ENSMUST00000174504
Predicted Effect possibly damaging
Transcript: ENSMUST00000178267
AA Change: Q380K

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: Q380K

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,356,949 I24K probably benign Het
Adamts9 A T 6: 92,872,335 C467S probably damaging Het
Adcy7 G A 8: 88,325,479 R925Q probably damaging Het
Akap6 G A 12: 53,140,215 G1471S probably damaging Het
Ap2b1 T C 11: 83,342,679 V506A probably damaging Het
Apob A G 12: 8,001,814 I1113M probably damaging Het
Arsg A T 11: 109,517,336 N105Y probably damaging Het
Blm T A 7: 80,481,475 Y872F probably damaging Het
Btaf1 A T 19: 36,983,617 N797Y probably benign Het
Camsap1 T C 2: 25,956,308 E201G probably damaging Het
Ccdc122 T A 14: 77,042,069 probably null Homo
Ccdc141 A G 2: 77,170,401 V29A probably damaging Het
Cd244 T A 1: 171,577,879 D277E probably benign Het
Cfap157 T C 2: 32,780,678 Y186C probably damaging Het
Ciita C T 16: 10,511,910 A686V probably damaging Het
Clptm1l T C 13: 73,617,765 probably null Het
Col16a1 C T 4: 130,055,994 P50L probably damaging Het
Crisp3 A T 17: 40,235,913 V38D probably damaging Het
Cyfip2 T C 11: 46,221,346 E1010G probably damaging Het
Dvl3 G A 16: 20,527,383 E488K probably damaging Het
Eed C A 7: 89,977,029 E45D probably benign Het
Eln A G 5: 134,725,774 probably benign Het
Fah T A 7: 84,594,835 I239F probably damaging Het
Fbxw5 T A 2: 25,502,436 Y77N possibly damaging Het
Garnl3 T C 2: 33,006,821 E602G possibly damaging Het
Gkn3 A T 6: 87,388,804 M11K probably benign Het
Glt1d1 A G 5: 127,706,981 Y333C probably damaging Het
Gm10762 A T 2: 128,967,170 Y86* probably null Het
Gm14496 A G 2: 182,000,593 M686V probably benign Het
Gse1 T A 8: 120,553,689 probably null Het
Herc4 C A 10: 63,317,418 T1035K probably benign Het
Hmcn2 T A 2: 31,382,478 N1323K probably damaging Het
Hnrnpd T A 5: 99,966,166 E3D probably damaging Het
Htr7 T A 19: 35,969,610 I335F probably damaging Het
Itgae A T 11: 73,145,592 I1119F probably benign Het
Lcn11 T C 2: 25,779,091 F137S probably benign Het
Lrp3 T G 7: 35,203,988 D311A possibly damaging Het
Lrrc1 G T 9: 77,442,191 D364E probably damaging Het
Lrrc37a T A 11: 103,492,179 E2456V unknown Het
Lrriq1 T C 10: 103,227,184 Y87C probably damaging Het
Mcc A T 18: 44,468,390 L449* probably null Het
Mcc A T 18: 44,468,391 L624M probably damaging Het
Mcm9 T C 10: 53,612,839 T496A probably damaging Het
Myef2 T A 2: 125,116,682 D109V probably damaging Het
Myom3 C T 4: 135,762,513 probably benign Het
Nanos1 G T 19: 60,756,539 G92W possibly damaging Het
Ncor1 T A 11: 62,381,414 K84* probably null Het
Neb T A 2: 52,291,082 D1171V probably benign Het
Notch3 A G 17: 32,158,217 W267R probably damaging Het
Olfr1167 A T 2: 88,150,016 M1K probably null Het
Olfr26 A C 9: 38,855,637 T192P probably damaging Het
Per2 A G 1: 91,427,763 S758P probably benign Het
Pi4k2a A G 19: 42,090,932 Q144R probably benign Het
Pirb A T 7: 3,717,393 V327E probably benign Het
Pla2g4a C T 1: 149,872,616 W272* probably null Het
Plekha4 T A 7: 45,530,576 M1K probably null Het
Ppt2 A G 17: 34,625,920 C117R probably damaging Het
Prph A T 15: 99,056,386 I222F probably damaging Het
Rbm43 T C 2: 51,925,576 D211G probably damaging Het
Rims2 A G 15: 39,534,855 D1072G probably benign Het
Rnf145 T C 11: 44,525,105 F49S probably damaging Het
Sall4 A G 2: 168,755,708 I404T probably damaging Het
Slc25a39 G A 11: 102,404,460 P228L probably damaging Het
Tbc1d14 T C 5: 36,520,481 T377A possibly damaging Het
Tbc1d17 A G 7: 44,841,625 I555T probably benign Het
Tmem131l A T 3: 83,922,408 S980T probably damaging Het
Tmem14a G T 1: 21,229,438 L97F possibly damaging Het
Tmem98 T C 11: 80,812,635 V26A probably benign Het
Tmppe G T 9: 114,405,652 G340W probably damaging Het
Tsc1 T C 2: 28,665,601 S237P probably damaging Het
Ttc30b T A 2: 75,937,104 N435I possibly damaging Het
Ubr4 C T 4: 139,444,671 R2992W probably damaging Het
Ugt2a2 A G 5: 87,460,459 V673A possibly damaging Het
Vmn2r19 T C 6: 123,316,108 Y370H possibly damaging Het
Vmn2r20 A G 6: 123,396,383 F500S possibly damaging Het
Zc3h7b A G 15: 81,769,051 Y47C probably benign Het
Zdhhc13 A G 7: 48,815,560 E406G possibly damaging Het
Zfp418 T C 7: 7,182,600 S521P possibly damaging Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 108067395 critical splice donor site probably null
IGL01358:Rnf123 APN 9 108069182 missense probably damaging 1.00
IGL01464:Rnf123 APN 9 108052302 missense probably damaging 1.00
IGL01637:Rnf123 APN 9 108058238 missense probably damaging 1.00
IGL01669:Rnf123 APN 9 108058356 missense probably damaging 0.98
IGL01905:Rnf123 APN 9 108071370 splice site probably benign
IGL02070:Rnf123 APN 9 108068302 nonsense probably null
IGL02072:Rnf123 APN 9 108068302 nonsense probably null
IGL02073:Rnf123 APN 9 108068302 nonsense probably null
IGL02074:Rnf123 APN 9 108066889 missense probably damaging 1.00
IGL02079:Rnf123 APN 9 108068302 nonsense probably null
IGL02080:Rnf123 APN 9 108068302 nonsense probably null
IGL02231:Rnf123 APN 9 108066399 missense probably benign 0.17
IGL02281:Rnf123 APN 9 108071452 missense probably benign 0.01
IGL02336:Rnf123 APN 9 108061842 missense probably damaging 1.00
IGL02543:Rnf123 APN 9 108066348 missense probably damaging 1.00
IGL02565:Rnf123 APN 9 108052212 critical splice donor site probably null
IGL02571:Rnf123 APN 9 108068302 nonsense probably null
IGL02572:Rnf123 APN 9 108068302 nonsense probably null
IGL02574:Rnf123 APN 9 108068302 nonsense probably null
IGL02586:Rnf123 APN 9 108068302 nonsense probably null
IGL02589:Rnf123 APN 9 108068302 nonsense probably null
IGL02600:Rnf123 APN 9 108068302 nonsense probably null
IGL02601:Rnf123 APN 9 108068302 nonsense probably null
IGL02602:Rnf123 APN 9 108068302 nonsense probably null
IGL02603:Rnf123 APN 9 108068302 nonsense probably null
IGL02609:Rnf123 APN 9 108068302 nonsense probably null
IGL02628:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108070789 splice site probably benign
IGL02630:Rnf123 APN 9 108068302 nonsense probably null
IGL02631:Rnf123 APN 9 108068302 nonsense probably null
IGL02632:Rnf123 APN 9 108068302 nonsense probably null
IGL02650:Rnf123 APN 9 108069748 missense probably benign 0.29
IGL02690:Rnf123 APN 9 108068302 nonsense probably null
IGL02691:Rnf123 APN 9 108068302 nonsense probably null
IGL02692:Rnf123 APN 9 108068302 nonsense probably null
IGL02693:Rnf123 APN 9 108068302 nonsense probably null
IGL02713:Rnf123 APN 9 108068302 nonsense probably null
IGL02736:Rnf123 APN 9 108068302 nonsense probably null
IGL02929:Rnf123 APN 9 108069076 missense probably benign
R1175:Rnf123 UTSW 9 108077373 missense probably benign
R1465:Rnf123 UTSW 9 108071466 splice site probably benign
R1502:Rnf123 UTSW 9 108068510 splice site probably null
R1682:Rnf123 UTSW 9 108077398 missense probably benign 0.16
R1817:Rnf123 UTSW 9 108062926 missense probably benign 0.41
R1855:Rnf123 UTSW 9 108061791 missense probably damaging 1.00
R2394:Rnf123 UTSW 9 108063536 missense probably benign 0.00
R2483:Rnf123 UTSW 9 108063521 missense probably benign 0.16
R3896:Rnf123 UTSW 9 108069103 splice site probably benign
R3940:Rnf123 UTSW 9 108064035 splice site probably benign
R4206:Rnf123 UTSW 9 108063963 missense probably benign 0.01
R4641:Rnf123 UTSW 9 108058587 missense probably damaging 1.00
R4714:Rnf123 UTSW 9 108052439 splice site probably null
R4767:Rnf123 UTSW 9 108052089 missense probably damaging 1.00
R4849:Rnf123 UTSW 9 108056091 missense probably damaging 1.00
R4899:Rnf123 UTSW 9 108063680 missense probably damaging 1.00
R5274:Rnf123 UTSW 9 108064003 frame shift probably null
R5275:Rnf123 UTSW 9 108064003 frame shift probably null
R5276:Rnf123 UTSW 9 108064003 frame shift probably null
R5294:Rnf123 UTSW 9 108064003 frame shift probably null
R5295:Rnf123 UTSW 9 108064003 frame shift probably null
R5394:Rnf123 UTSW 9 108070731 missense probably damaging 1.00
R5717:Rnf123 UTSW 9 108067424 missense probably damaging 1.00
R6186:Rnf123 UTSW 9 108069958 missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 108056053 missense probably benign 0.17
R6944:Rnf123 UTSW 9 108063623 missense probably benign 0.02
R7003:Rnf123 UTSW 9 108063683 critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 108058536 missense probably null 1.00
R7092:Rnf123 UTSW 9 108068600 missense probably benign 0.07
R7100:Rnf123 UTSW 9 108056639 missense probably damaging 1.00
R7257:Rnf123 UTSW 9 108069029 missense probably damaging 1.00
R7453:Rnf123 UTSW 9 108070408 splice site probably null
R7468:Rnf123 UTSW 9 108069009 missense probably benign 0.00
R7517:Rnf123 UTSW 9 108070274 nonsense probably null
R7577:Rnf123 UTSW 9 108070619 missense probably damaging 1.00
R8296:Rnf123 UTSW 9 108062890 missense probably damaging 1.00
R8322:Rnf123 UTSW 9 108068507 missense probably benign 0.26
R8754:Rnf123 UTSW 9 108071164 missense probably damaging 1.00
R8783:Rnf123 UTSW 9 108069073 missense probably benign
R9052:Rnf123 UTSW 9 108059731 missense probably damaging 1.00
R9156:Rnf123 UTSW 9 108063028 splice site probably benign
R9170:Rnf123 UTSW 9 108071176 missense probably damaging 1.00
R9332:Rnf123 UTSW 9 108067505 missense probably benign 0.00
R9385:Rnf123 UTSW 9 108052268 missense probably benign 0.02
R9394:Rnf123 UTSW 9 108065706 missense probably damaging 1.00
R9432:Rnf123 UTSW 9 108059809 missense probably damaging 0.96
R9717:Rnf123 UTSW 9 108077764 missense probably benign 0.43
Z1176:Rnf123 UTSW 9 108058395 missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 108062981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGTATTACATGGCAGATCTGTC -3'
(R):5'- AGATCTTGGACCTCTTGTGGC -3'

Sequencing Primer
(F):5'- CATTGCTAAGCAGGAACTTGC -3'
(R):5'- CTCTTCATGGAGGTAAGATTTCTGAC -3'
Posted On 2018-06-06