Incidental Mutation 'R6502:Rims2'
ID519820
Institutional Source Beutler Lab
Gene Symbol Rims2
Ensembl Gene ENSMUSG00000037386
Gene Nameregulating synaptic membrane exocytosis 2
Synonyms2810036I15Rik, Syt3-rs, RIM2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R6502 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location39198261-39684372 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39534855 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1072 (D1072G)
Ref Sequence ENSEMBL: ENSMUSP00000048719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042917] [ENSMUST00000082054] [ENSMUST00000227243]
Predicted Effect probably benign
Transcript: ENSMUST00000042917
AA Change: D1072G

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048719
Gene: ENSMUSG00000037386
AA Change: D1072G

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:FYVE_2 30 154 9.5e-18 PFAM
low complexity region 315 335 N/A INTRINSIC
low complexity region 492 498 N/A INTRINSIC
low complexity region 511 521 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
PDZ 646 725 8.27e-16 SMART
low complexity region 740 748 N/A INTRINSIC
C2 790 897 4.08e-21 SMART
low complexity region 905 919 N/A INTRINSIC
low complexity region 1085 1101 N/A INTRINSIC
low complexity region 1116 1130 N/A INTRINSIC
low complexity region 1208 1238 N/A INTRINSIC
C2 1432 1535 3.78e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000082054
SMART Domains Protein: ENSMUSP00000080711
Gene: ENSMUSG00000037386

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:FYVE_2 76 194 2.2e-11 PFAM
low complexity region 355 375 N/A INTRINSIC
low complexity region 532 538 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
low complexity region 567 580 N/A INTRINSIC
PDZ 686 765 8.27e-16 SMART
low complexity region 780 788 N/A INTRINSIC
C2 830 937 4.08e-21 SMART
low complexity region 945 959 N/A INTRINSIC
low complexity region 1075 1086 N/A INTRINSIC
low complexity region 1166 1196 N/A INTRINSIC
C2 1390 1493 3.78e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227243
AA Change: D1050G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect unknown
Transcript: ENSMUST00000227381
AA Change: D770G
Meta Mutation Damage Score 0.1255 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a presynaptic protein that interacts with RAB3, a protein important for normal neurotransmitter release. The encoded protein can also bind several other synaptic proteins, including UNC-13 homolog B, ELKS/Rab6-interacting/CAST family member 1, and synaptotagmin 1. This protein is involved in synaptic membrane exocytosis. Polymorphisms in this gene have been associated with degenerative lumbar scoliosis. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele show reduced body size, aberrant insulin granule exocytosis, and impaired secretion of hormones associated with glucose homeostasis. Mice homozygous for another knock-out allele show a slightly reduced body size, abnormal maternal behavior and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,356,949 I24K probably benign Het
Adamts9 A T 6: 92,872,335 C467S probably damaging Het
Adcy7 G A 8: 88,325,479 R925Q probably damaging Het
Akap6 G A 12: 53,140,215 G1471S probably damaging Het
Ap2b1 T C 11: 83,342,679 V506A probably damaging Het
Apob A G 12: 8,001,814 I1113M probably damaging Het
Arsg A T 11: 109,517,336 N105Y probably damaging Het
Blm T A 7: 80,481,475 Y872F probably damaging Het
Btaf1 A T 19: 36,983,617 N797Y probably benign Het
Camsap1 T C 2: 25,956,308 E201G probably damaging Het
Ccdc122 T A 14: 77,042,069 probably null Homo
Ccdc141 A G 2: 77,170,401 V29A probably damaging Het
Cd244 T A 1: 171,577,879 D277E probably benign Het
Cfap157 T C 2: 32,780,678 Y186C probably damaging Het
Ciita C T 16: 10,511,910 A686V probably damaging Het
Clptm1l T C 13: 73,617,765 probably null Het
Col16a1 C T 4: 130,055,994 P50L probably damaging Het
Crisp3 A T 17: 40,235,913 V38D probably damaging Het
Cyfip2 T C 11: 46,221,346 E1010G probably damaging Het
Dvl3 G A 16: 20,527,383 E488K probably damaging Het
Eed C A 7: 89,977,029 E45D probably benign Het
Eln A G 5: 134,725,774 probably benign Het
Fah T A 7: 84,594,835 I239F probably damaging Het
Fbxw5 T A 2: 25,502,436 Y77N possibly damaging Het
Garnl3 T C 2: 33,006,821 E602G possibly damaging Het
Gkn3 A T 6: 87,388,804 M11K probably benign Het
Glt1d1 A G 5: 127,706,981 Y333C probably damaging Het
Gm10762 A T 2: 128,967,170 Y86* probably null Het
Gm14496 A G 2: 182,000,593 M686V probably benign Het
Gse1 T A 8: 120,553,689 probably null Het
Herc4 C A 10: 63,317,418 T1035K probably benign Het
Hmcn2 T A 2: 31,382,478 N1323K probably damaging Het
Hnrnpd T A 5: 99,966,166 E3D probably damaging Het
Htr7 T A 19: 35,969,610 I335F probably damaging Het
Itgae A T 11: 73,145,592 I1119F probably benign Het
Lcn11 T C 2: 25,779,091 F137S probably benign Het
Lrp3 T G 7: 35,203,988 D311A possibly damaging Het
Lrrc1 G T 9: 77,442,191 D364E probably damaging Het
Lrrc37a T A 11: 103,492,179 E2456V unknown Het
Lrriq1 T C 10: 103,227,184 Y87C probably damaging Het
Mcc A T 18: 44,468,390 L449* probably null Het
Mcc A T 18: 44,468,391 L624M probably damaging Het
Mcm9 T C 10: 53,612,839 T496A probably damaging Het
Myef2 T A 2: 125,116,682 D109V probably damaging Het
Myom3 C T 4: 135,762,513 probably benign Het
Nanos1 G T 19: 60,756,539 G92W possibly damaging Het
Ncor1 T A 11: 62,381,414 K84* probably null Het
Neb T A 2: 52,291,082 D1171V probably benign Het
Notch3 A G 17: 32,158,217 W267R probably damaging Het
Olfr1167 A T 2: 88,150,016 M1K probably null Het
Olfr26 A C 9: 38,855,637 T192P probably damaging Het
Per2 A G 1: 91,427,763 S758P probably benign Het
Pi4k2a A G 19: 42,090,932 Q144R probably benign Het
Pirb A T 7: 3,717,393 V327E probably benign Het
Pla2g4a C T 1: 149,872,616 W272* probably null Het
Plekha4 T A 7: 45,530,576 M1K probably null Het
Ppt2 A G 17: 34,625,920 C117R probably damaging Het
Prph A T 15: 99,056,386 I222F probably damaging Het
Rbm43 T C 2: 51,925,576 D211G probably damaging Het
Rnf123 G T 9: 108,068,332 Q380K possibly damaging Het
Rnf145 T C 11: 44,525,105 F49S probably damaging Het
Sall4 A G 2: 168,755,708 I404T probably damaging Het
Slc25a39 G A 11: 102,404,460 P228L probably damaging Het
Tbc1d14 T C 5: 36,520,481 T377A possibly damaging Het
Tbc1d17 A G 7: 44,841,625 I555T probably benign Het
Tmem131l A T 3: 83,922,408 S980T probably damaging Het
Tmem14a G T 1: 21,229,438 L97F possibly damaging Het
Tmem98 T C 11: 80,812,635 V26A probably benign Het
Tmppe G T 9: 114,405,652 G340W probably damaging Het
Tsc1 T C 2: 28,665,601 S237P probably damaging Het
Ttc30b T A 2: 75,937,104 N435I possibly damaging Het
Ubr4 C T 4: 139,444,671 R2992W probably damaging Het
Ugt2a2 A G 5: 87,460,459 V673A possibly damaging Het
Vmn2r19 T C 6: 123,316,108 Y370H possibly damaging Het
Vmn2r20 A G 6: 123,396,383 F500S possibly damaging Het
Zc3h7b A G 15: 81,769,051 Y47C probably benign Het
Zdhhc13 A G 7: 48,815,560 E406G possibly damaging Het
Zfp418 T C 7: 7,182,600 S521P possibly damaging Het
Other mutations in Rims2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Rims2 APN 15 39459615 missense probably benign 0.11
IGL00502:Rims2 APN 15 39506984 missense probably damaging 1.00
IGL00556:Rims2 APN 15 39456674 splice site probably null
IGL00811:Rims2 APN 15 39292149 missense probably damaging 1.00
IGL00827:Rims2 APN 15 39472359 missense probably damaging 0.99
IGL01642:Rims2 APN 15 39457796 missense probably damaging 1.00
IGL02951:Rims2 APN 15 39534938 missense probably damaging 1.00
IGL03009:Rims2 APN 15 39566997 missense possibly damaging 0.85
IGL03080:Rims2 APN 15 39535903 missense probably damaging 1.00
IGL03102:Rims2 APN 15 39459593 missense possibly damaging 0.95
IGL03252:Rims2 APN 15 39452352 missense probably benign
IGL03365:Rims2 APN 15 39476541 missense probably damaging 1.00
IGL03393:Rims2 APN 15 39462613 splice site probably null
IGL03409:Rims2 APN 15 39456733 missense probably damaging 1.00
PIT4486001:Rims2 UTSW 15 39476520 missense possibly damaging 0.67
R0009:Rims2 UTSW 15 39534966 missense probably damaging 0.99
R0009:Rims2 UTSW 15 39534966 missense probably damaging 0.99
R0078:Rims2 UTSW 15 39534855 missense probably benign 0.42
R0367:Rims2 UTSW 15 39462615 splice site probably null
R0401:Rims2 UTSW 15 39509632 splice site probably benign
R0531:Rims2 UTSW 15 39567030 missense probably damaging 1.00
R0791:Rims2 UTSW 15 39679625 splice site probably benign
R0838:Rims2 UTSW 15 39681025 missense probably benign 0.02
R1201:Rims2 UTSW 15 39616324 missense possibly damaging 0.91
R1318:Rims2 UTSW 15 39517826 missense probably damaging 0.99
R1457:Rims2 UTSW 15 39511314 missense possibly damaging 0.63
R1619:Rims2 UTSW 15 39506986 missense probably damaging 1.00
R1672:Rims2 UTSW 15 39292189 missense probably benign 0.09
R1743:Rims2 UTSW 15 39679650 missense probably benign 0.10
R1766:Rims2 UTSW 15 39462580 missense probably damaging 0.99
R1779:Rims2 UTSW 15 39681702 missense probably damaging 1.00
R1804:Rims2 UTSW 15 39437043 nonsense probably null
R1985:Rims2 UTSW 15 39345314 missense probably damaging 0.99
R1986:Rims2 UTSW 15 39345314 missense probably damaging 0.99
R2113:Rims2 UTSW 15 39511326 missense probably benign 0.17
R2260:Rims2 UTSW 15 39478566 nonsense probably null
R2510:Rims2 UTSW 15 39585652 missense probably damaging 1.00
R3693:Rims2 UTSW 15 39478575 missense probably benign 0.01
R3937:Rims2 UTSW 15 39437845 missense probably damaging 1.00
R4425:Rims2 UTSW 15 39437924 critical splice donor site probably null
R4453:Rims2 UTSW 15 39292208 missense probably damaging 1.00
R4474:Rims2 UTSW 15 39462560 missense probably damaging 1.00
R4518:Rims2 UTSW 15 39437526 missense probably damaging 1.00
R4526:Rims2 UTSW 15 39437717 missense probably damaging 1.00
R4833:Rims2 UTSW 15 39535914 missense probably damaging 0.98
R4936:Rims2 UTSW 15 39437728 missense probably damaging 1.00
R4993:Rims2 UTSW 15 39454445 missense possibly damaging 0.90
R5001:Rims2 UTSW 15 39452428 missense probably benign 0.03
R5054:Rims2 UTSW 15 39517869 intron probably null
R5072:Rims2 UTSW 15 39462590 missense probably benign 0.01
R5171:Rims2 UTSW 15 39437103 missense probably damaging 1.00
R5429:Rims2 UTSW 15 39345355 missense probably damaging 1.00
R5623:Rims2 UTSW 15 39478615 missense probably damaging 1.00
R5624:Rims2 UTSW 15 39345413 missense possibly damaging 0.46
R5685:Rims2 UTSW 15 39437206 missense possibly damaging 0.67
R5784:Rims2 UTSW 15 39535987 splice site probably null
R5790:Rims2 UTSW 15 39681045 missense probably damaging 1.00
R5822:Rims2 UTSW 15 39476490 missense probably damaging 1.00
R5963:Rims2 UTSW 15 39437182 missense probably damaging 1.00
R5988:Rims2 UTSW 15 39292182 missense probably damaging 1.00
R6057:Rims2 UTSW 15 39675020 missense probably damaging 1.00
R6239:Rims2 UTSW 15 39198363 start codon destroyed unknown
R6407:Rims2 UTSW 15 39452328 missense probably damaging 1.00
R6418:Rims2 UTSW 15 39509696 missense probably damaging 1.00
R6495:Rims2 UTSW 15 39517812 missense probably benign 0.01
R6753:Rims2 UTSW 15 39566973 missense possibly damaging 0.74
R6855:Rims2 UTSW 15 39345515 missense probably benign 0.06
R6948:Rims2 UTSW 15 39511341 missense probably benign
R7058:Rims2 UTSW 15 39585648 missense probably damaging 1.00
R7167:Rims2 UTSW 15 39437077 missense probably benign
R7217:Rims2 UTSW 15 39476489 missense probably damaging 0.99
R7223:Rims2 UTSW 15 39437032 missense probably benign 0.30
R7289:Rims2 UTSW 15 39437718 missense probably benign 0.00
R7459:Rims2 UTSW 15 39517839 missense probably benign
R7663:Rims2 UTSW 15 39507026 missense probably damaging 1.00
X0034:Rims2 UTSW 15 39437534 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTTGGTTTGCATCGCTTATAAC -3'
(R):5'- TGCAGACAGGGAAATTAGTCTG -3'

Sequencing Primer
(F):5'- GCATCGCTTATAACTGAGCAAG -3'
(R):5'- GACAGGGAAATTAGTCTGATCAATG -3'
Posted On2018-06-06