Mutagenetix > Incidental Mutations

Incidental Mutation 'R6502:Notch3'

519825

Institutional Source

Beutler Lab

Gene Symbol

Notch3

Ensembl Gene

ENSMUSG00000038146

Gene Name

notch 3

Synonyms

N3, hpbk

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6502 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

32120820-32166880 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32158217 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 267 (W267R)

Ref Sequence

ENSEMBL: ENSMUSP00000085016 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087723]

Predicted Effect

probably damaging
Transcript: ENSMUST00000087723
AA Change: W267R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000085016
Gene: ENSMUSG00000038146
AA Change: W267R

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
EGF	42	78	3.73e-5	SMART
EGF	82	119	1.78e-2	SMART
EGF	123	157	1.13e-4	SMART
EGF_CA	159	196	1.89e-15	SMART
EGF	201	235	3.85e-7	SMART
EGF_CA	237	273	3.97e-9	SMART
EGF_CA	275	313	4.63e-10	SMART
EGF_CA	315	351	1.05e-8	SMART
EGF	355	390	1.28e-3	SMART
EGF_CA	392	430	6.29e-12	SMART
EGF_CA	432	468	1.11e-12	SMART
EGF_CA	470	506	4.21e-13	SMART
EGF_CA	508	544	8.43e-13	SMART
EGF_CA	546	581	9.54e-12	SMART
EGF_CA	583	619	1.31e-9	SMART
EGF_CA	621	656	2.03e-6	SMART
EGF_CA	658	694	2.28e-9	SMART
EGF	699	731	7.18e-7	SMART
EGF	738	771	2.5e-6	SMART
EGF	775	809	8e-5	SMART
EGF_CA	811	848	4.77e-12	SMART
EGF_CA	850	886	3.81e-11	SMART
EGF_CA	888	923	1.47e-12	SMART
EGF_CA	925	961	3.4e-8	SMART
EGF	966	999	5.74e-6	SMART
EGF	1004	1035	7.18e-7	SMART
EGF	1040	1083	1.21e-4	SMART
EGF_CA	1085	1121	1.29e-8	SMART
EGF_CA	1123	1159	1.45e-11	SMART
EGF_CA	1161	1204	1.26e-11	SMART
EGF	1209	1245	1.53e-1	SMART
EGF	1250	1288	8e-5	SMART
EGF	1293	1326	1.13e1	SMART
EGF	1339	1374	5.36e-6	SMART
NL	1381	1419	1.63e-15	SMART
NL	1422	1460	1.78e-16	SMART
NL	1461	1502	1.75e-15	SMART
NOD	1506	1562	2.98e-24	SMART
NODP	1577	1641	1.34e-26	SMART
transmembrane domain	1644	1666	N/A	INTRINSIC
low complexity region	1774	1783	N/A	INTRINSIC
ANK	1789	1834	1.48e3	SMART
ANK	1839	1868	1.61e-4	SMART
ANK	1872	1902	1.42e0	SMART
ANK	1906	1935	1.77e-1	SMART
ANK	1939	1968	3.18e-3	SMART
ANK	1972	2001	5.16e-3	SMART
low complexity region	2028	2054	N/A	INTRINSIC
low complexity region	2108	2123	N/A	INTRINSIC
low complexity region	2169	2193	N/A	INTRINSIC
DUF3454	2218	2275	2.81e-20	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
PHENOTYPE: Some, but not all, null alleles cause defects in artery morphology and in T cell development. Progressive emaciation and kyphosis with paraphimosis occurs in an intron 31 splice donor site point mutant. In conjunction with Notch1 deficiency, abnormalities in embryonic development have been observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013D24Rik	A	T	6: 124,356,949	I24K	probably benign	Het
Adamts9	A	T	6: 92,872,335	C467S	probably damaging	Het
Adcy7	G	A	8: 88,325,479	R925Q	probably damaging	Het
Akap6	G	A	12: 53,140,215	G1471S	probably damaging	Het
Ap2b1	T	C	11: 83,342,679	V506A	probably damaging	Het
Apob	A	G	12: 8,001,814	I1113M	probably damaging	Het
Arsg	A	T	11: 109,517,336	N105Y	probably damaging	Het
Blm	T	A	7: 80,481,475	Y872F	probably damaging	Het
Btaf1	A	T	19: 36,983,617	N797Y	probably benign	Het
Camsap1	T	C	2: 25,956,308	E201G	probably damaging	Het
Ccdc122	T	A	14: 77,042,069		probably null	Homo
Ccdc141	A	G	2: 77,170,401	V29A	probably damaging	Het
Cd244	T	A	1: 171,577,879	D277E	probably benign	Het
Cfap157	T	C	2: 32,780,678	Y186C	probably damaging	Het
Ciita	C	T	16: 10,511,910	A686V	probably damaging	Het
Clptm1l	T	C	13: 73,617,765		probably null	Het
Col16a1	C	T	4: 130,055,994	P50L	probably damaging	Het
Crisp3	A	T	17: 40,235,913	V38D	probably damaging	Het
Cyfip2	T	C	11: 46,221,346	E1010G	probably damaging	Het
Dvl3	G	A	16: 20,527,383	E488K	probably damaging	Het
Eed	C	A	7: 89,977,029	E45D	probably benign	Het
Eln	A	G	5: 134,725,774		probably benign	Het
Fah	T	A	7: 84,594,835	I239F	probably damaging	Het
Fbxw5	T	A	2: 25,502,436	Y77N	possibly damaging	Het
Garnl3	T	C	2: 33,006,821	E602G	possibly damaging	Het
Gkn3	A	T	6: 87,388,804	M11K	probably benign	Het
Glt1d1	A	G	5: 127,706,981	Y333C	probably damaging	Het
Gm10762	A	T	2: 128,967,170	Y86*	probably null	Het
Gm14496	A	G	2: 182,000,593	M686V	probably benign	Het
Gse1	T	A	8: 120,553,689		probably null	Het
Herc4	C	A	10: 63,317,418	T1035K	probably benign	Het
Hmcn2	T	A	2: 31,382,478	N1323K	probably damaging	Het
Hnrnpd	T	A	5: 99,966,166	E3D	probably damaging	Het
Htr7	T	A	19: 35,969,610	I335F	probably damaging	Het
Itgae	A	T	11: 73,145,592	I1119F	probably benign	Het
Lcn11	T	C	2: 25,779,091	F137S	probably benign	Het
Lrp3	T	G	7: 35,203,988	D311A	possibly damaging	Het
Lrrc1	G	T	9: 77,442,191	D364E	probably damaging	Het
Lrrc37a	T	A	11: 103,492,179	E2456V	unknown	Het
Lrriq1	T	C	10: 103,227,184	Y87C	probably damaging	Het
Mcc	A	T	18: 44,468,390	L449*	probably null	Het
Mcc	A	T	18: 44,468,391	L624M	probably damaging	Het
Mcm9	T	C	10: 53,612,839	T496A	probably damaging	Het
Myef2	T	A	2: 125,116,682	D109V	probably damaging	Het
Myom3	C	T	4: 135,762,513		probably benign	Het
Nanos1	G	T	19: 60,756,539	G92W	possibly damaging	Het
Ncor1	T	A	11: 62,381,414	K84*	probably null	Het
Neb	T	A	2: 52,291,082	D1171V	probably benign	Het
Olfr1167	A	T	2: 88,150,016	M1K	probably null	Het
Olfr26	A	C	9: 38,855,637	T192P	probably damaging	Het
Per2	A	G	1: 91,427,763	S758P	probably benign	Het
Pi4k2a	A	G	19: 42,090,932	Q144R	probably benign	Het
Pirb	A	T	7: 3,717,393	V327E	probably benign	Het
Pla2g4a	C	T	1: 149,872,616	W272*	probably null	Het
Plekha4	T	A	7: 45,530,576	M1K	probably null	Het
Ppt2	A	G	17: 34,625,920	C117R	probably damaging	Het
Prph	A	T	15: 99,056,386	I222F	probably damaging	Het
Rbm43	T	C	2: 51,925,576	D211G	probably damaging	Het
Rims2	A	G	15: 39,534,855	D1072G	probably benign	Het
Rnf123	G	T	9: 108,068,332	Q380K	possibly damaging	Het
Rnf145	T	C	11: 44,525,105	F49S	probably damaging	Het
Sall4	A	G	2: 168,755,708	I404T	probably damaging	Het
Slc25a39	G	A	11: 102,404,460	P228L	probably damaging	Het
Tbc1d14	T	C	5: 36,520,481	T377A	possibly damaging	Het
Tbc1d17	A	G	7: 44,841,625	I555T	probably benign	Het
Tmem131l	A	T	3: 83,922,408	S980T	probably damaging	Het
Tmem14a	G	T	1: 21,229,438	L97F	possibly damaging	Het
Tmem98	T	C	11: 80,812,635	V26A	probably benign	Het
Tmppe	G	T	9: 114,405,652	G340W	probably damaging	Het
Tsc1	T	C	2: 28,665,601	S237P	probably damaging	Het
Ttc30b	T	A	2: 75,937,104	N435I	possibly damaging	Het
Ubr4	C	T	4: 139,444,671	R2992W	probably damaging	Het
Ugt2a2	A	G	5: 87,460,459	V673A	possibly damaging	Het
Vmn2r19	T	C	6: 123,316,108	Y370H	possibly damaging	Het
Vmn2r20	A	G	6: 123,396,383	F500S	possibly damaging	Het
Zc3h7b	A	G	15: 81,769,051	Y47C	probably benign	Het
Zdhhc13	A	G	7: 48,815,560	E406G	possibly damaging	Het
Zfp418	T	C	7: 7,182,600	S521P	possibly damaging	Het

Other mutations in Notch3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Notch3	APN	17	32158114	nonsense	probably null
IGL01065:Notch3	APN	17	32146416	nonsense	probably null
IGL01296:Notch3	APN	17	32166757	missense	unknown
IGL01322:Notch3	APN	17	32144471	missense	probably damaging	1.00
IGL01343:Notch3	APN	17	32143436	missense	probably benign	0.10
IGL01358:Notch3	APN	17	32144747	missense	probably damaging	1.00
IGL01600:Notch3	APN	17	32144498	missense	probably damaging	1.00
IGL01622:Notch3	APN	17	32158870	missense	possibly damaging	0.50
IGL01623:Notch3	APN	17	32158870	missense	possibly damaging	0.50
IGL01971:Notch3	APN	17	32124347	missense	probably damaging	1.00
IGL02000:Notch3	APN	17	32122742	missense	probably damaging	0.99
IGL02072:Notch3	APN	17	32147074	nonsense	probably null
IGL02145:Notch3	APN	17	32154741	missense	probably benign	0.01
IGL02256:Notch3	APN	17	32132324	missense	probably damaging	1.00
IGL02366:Notch3	APN	17	32144205	missense	probably benign
IGL02476:Notch3	APN	17	32158638	missense	possibly damaging	0.67
IGL02502:Notch3	APN	17	32158278	nonsense	probably null
IGL02551:Notch3	APN	17	32154731	splice site	probably benign
divide	UTSW	17	32137813	splice site	probably null
Lopressor	UTSW	17	32153884	missense	probably damaging	1.00
PIT4486001:Notch3	UTSW	17	32154763	missense	probably damaging	1.00
R0115:Notch3	UTSW	17	32133462	missense	possibly damaging	0.82
R0201:Notch3	UTSW	17	32156148	splice site	probably benign
R0630:Notch3	UTSW	17	32147472	splice site	probably benign
R1167:Notch3	UTSW	17	32122745	missense	possibly damaging	0.95
R1432:Notch3	UTSW	17	32164224	missense	probably benign
R1567:Notch3	UTSW	17	32158580	missense	possibly damaging	0.77
R1623:Notch3	UTSW	17	32139191	missense	probably benign	0.00
R1663:Notch3	UTSW	17	32156119	missense	probably damaging	1.00
R1668:Notch3	UTSW	17	32158589	missense	probably damaging	0.99
R1789:Notch3	UTSW	17	32158725	missense	probably damaging	1.00
R1813:Notch3	UTSW	17	32143428	missense	probably benign	0.08
R1837:Notch3	UTSW	17	32124322	missense	probably damaging	1.00
R1896:Notch3	UTSW	17	32143428	missense	probably benign	0.08
R1937:Notch3	UTSW	17	32153852	missense	probably benign	0.03
R1954:Notch3	UTSW	17	32166678	missense	probably benign
R2014:Notch3	UTSW	17	32158000	missense	probably benign	0.00
R2058:Notch3	UTSW	17	32143644	missense	probably benign
R2068:Notch3	UTSW	17	32135508	missense	probably benign	0.00
R2097:Notch3	UTSW	17	32122754	missense	probably damaging	1.00
R2112:Notch3	UTSW	17	32144610	missense	probably benign	0.19
R2156:Notch3	UTSW	17	32147844	missense	probably damaging	1.00
R2211:Notch3	UTSW	17	32147978	missense	probably benign	0.00
R2324:Notch3	UTSW	17	32150134	splice site	probably benign
R2432:Notch3	UTSW	17	32153804	missense	probably damaging	1.00
R3117:Notch3	UTSW	17	32158115	missense	probably damaging	1.00
R3236:Notch3	UTSW	17	32158461	missense	probably damaging	0.96
R3409:Notch3	UTSW	17	32150702	missense	possibly damaging	0.67
R3434:Notch3	UTSW	17	32158618	missense	possibly damaging	0.80
R3435:Notch3	UTSW	17	32158618	missense	possibly damaging	0.80
R3438:Notch3	UTSW	17	32153590	missense	probably damaging	1.00
R3926:Notch3	UTSW	17	32153557	missense	possibly damaging	0.92
R4087:Notch3	UTSW	17	32158113	missense	possibly damaging	0.60
R4115:Notch3	UTSW	17	32158433	missense	probably damaging	1.00
R4214:Notch3	UTSW	17	32132207	missense	possibly damaging	0.96
R4234:Notch3	UTSW	17	32141341	missense	probably damaging	0.97
R4242:Notch3	UTSW	17	32143745	missense	possibly damaging	0.74
R4658:Notch3	UTSW	17	32154763	missense	probably damaging	1.00
R4878:Notch3	UTSW	17	32147085	missense	probably damaging	1.00
R4879:Notch3	UTSW	17	32147963	missense	probably benign	0.00
R4885:Notch3	UTSW	17	32141377	missense	probably damaging	0.98
R4924:Notch3	UTSW	17	32144731	missense	probably damaging	1.00
R5084:Notch3	UTSW	17	32157890	critical splice donor site	probably null
R5086:Notch3	UTSW	17	32143334	missense	probably benign	0.13
R5343:Notch3	UTSW	17	32143283	missense	probably benign	0.03
R5389:Notch3	UTSW	17	32139189	missense	probably benign
R5503:Notch3	UTSW	17	32147055	missense	probably benign	0.00
R5698:Notch3	UTSW	17	32157987	missense	probably damaging	1.00
R5824:Notch3	UTSW	17	32153861	missense	possibly damaging	0.92
R5969:Notch3	UTSW	17	32153884	missense	probably damaging	1.00
R6050:Notch3	UTSW	17	32143527	missense	probably benign
R6274:Notch3	UTSW	17	32147290	missense	probably benign
R6276:Notch3	UTSW	17	32154749	missense	probably benign	0.10
R6313:Notch3	UTSW	17	32151154	intron	probably null
R6316:Notch3	UTSW	17	32137813	splice site	probably null
R6380:Notch3	UTSW	17	32144559	missense	probably damaging	1.00
R6401:Notch3	UTSW	17	32158623	missense	probably benign	0.01
R6741:Notch3	UTSW	17	32143484	missense	probably benign	0.16
R7131:Notch3	UTSW	17	32144217	missense	probably benign
R7140:Notch3	UTSW	17	32156377	missense	possibly damaging	0.84
R7162:Notch3	UTSW	17	32146449	missense	probably damaging	0.98
R7171:Notch3	UTSW	17	32158962	missense	probably damaging	1.00
R7449:Notch3	UTSW	17	32157966	missense	probably damaging	1.00
R7450:Notch3	UTSW	17	32141391	missense	possibly damaging	0.69
R7554:Notch3	UTSW	17	32122371	missense	probably benign	0.03
R7575:Notch3	UTSW	17	32154819	missense	possibly damaging	0.81
R7632:Notch3	UTSW	17	32158506	missense	probably benign
R7633:Notch3	UTSW	17	32158622	missense	probably benign	0.17
T0975:Notch3	UTSW	17	32146417	missense	probably damaging	0.99
Z1088:Notch3	UTSW	17	32158652	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CCAGTAGGTTGAAGCAGGTACC -3'
(R):5'- TCACATATGACTGTGCTTGCC -3'

Sequencing Primer
(F):5'- TTGAAGCAGGTACCCCCATTGTG -3'
(R):5'- CCTGGTAAGTAAGTTGTGCCCAG -3'

Posted On

2018-06-06