Incidental Mutation 'R6502:Notch3'
ID519825
Institutional Source Beutler Lab
Gene Symbol Notch3
Ensembl Gene ENSMUSG00000038146
Gene Namenotch 3
SynonymsN3, hpbk
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6502 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location32120820-32166880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32158217 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 267 (W267R)
Ref Sequence ENSEMBL: ENSMUSP00000085016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087723]
Predicted Effect probably damaging
Transcript: ENSMUST00000087723
AA Change: W267R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085016
Gene: ENSMUSG00000038146
AA Change: W267R

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
EGF 42 78 3.73e-5 SMART
EGF 82 119 1.78e-2 SMART
EGF 123 157 1.13e-4 SMART
EGF_CA 159 196 1.89e-15 SMART
EGF 201 235 3.85e-7 SMART
EGF_CA 237 273 3.97e-9 SMART
EGF_CA 275 313 4.63e-10 SMART
EGF_CA 315 351 1.05e-8 SMART
EGF 355 390 1.28e-3 SMART
EGF_CA 392 430 6.29e-12 SMART
EGF_CA 432 468 1.11e-12 SMART
EGF_CA 470 506 4.21e-13 SMART
EGF_CA 508 544 8.43e-13 SMART
EGF_CA 546 581 9.54e-12 SMART
EGF_CA 583 619 1.31e-9 SMART
EGF_CA 621 656 2.03e-6 SMART
EGF_CA 658 694 2.28e-9 SMART
EGF 699 731 7.18e-7 SMART
EGF 738 771 2.5e-6 SMART
EGF 775 809 8e-5 SMART
EGF_CA 811 848 4.77e-12 SMART
EGF_CA 850 886 3.81e-11 SMART
EGF_CA 888 923 1.47e-12 SMART
EGF_CA 925 961 3.4e-8 SMART
EGF 966 999 5.74e-6 SMART
EGF 1004 1035 7.18e-7 SMART
EGF 1040 1083 1.21e-4 SMART
EGF_CA 1085 1121 1.29e-8 SMART
EGF_CA 1123 1159 1.45e-11 SMART
EGF_CA 1161 1204 1.26e-11 SMART
EGF 1209 1245 1.53e-1 SMART
EGF 1250 1288 8e-5 SMART
EGF 1293 1326 1.13e1 SMART
EGF 1339 1374 5.36e-6 SMART
NL 1381 1419 1.63e-15 SMART
NL 1422 1460 1.78e-16 SMART
NL 1461 1502 1.75e-15 SMART
NOD 1506 1562 2.98e-24 SMART
NODP 1577 1641 1.34e-26 SMART
transmembrane domain 1644 1666 N/A INTRINSIC
low complexity region 1774 1783 N/A INTRINSIC
ANK 1789 1834 1.48e3 SMART
ANK 1839 1868 1.61e-4 SMART
ANK 1872 1902 1.42e0 SMART
ANK 1906 1935 1.77e-1 SMART
ANK 1939 1968 3.18e-3 SMART
ANK 1972 2001 5.16e-3 SMART
low complexity region 2028 2054 N/A INTRINSIC
low complexity region 2108 2123 N/A INTRINSIC
low complexity region 2169 2193 N/A INTRINSIC
DUF3454 2218 2275 2.81e-20 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
PHENOTYPE: Some, but not all, null alleles cause defects in artery morphology and in T cell development. Progressive emaciation and kyphosis with paraphimosis occurs in an intron 31 splice donor site point mutant. In conjunction with Notch1 deficiency, abnormalities in embryonic development have been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,356,949 I24K probably benign Het
Adamts9 A T 6: 92,872,335 C467S probably damaging Het
Adcy7 G A 8: 88,325,479 R925Q probably damaging Het
Akap6 G A 12: 53,140,215 G1471S probably damaging Het
Ap2b1 T C 11: 83,342,679 V506A probably damaging Het
Apob A G 12: 8,001,814 I1113M probably damaging Het
Arsg A T 11: 109,517,336 N105Y probably damaging Het
Blm T A 7: 80,481,475 Y872F probably damaging Het
Btaf1 A T 19: 36,983,617 N797Y probably benign Het
Camsap1 T C 2: 25,956,308 E201G probably damaging Het
Ccdc122 T A 14: 77,042,069 probably null Homo
Ccdc141 A G 2: 77,170,401 V29A probably damaging Het
Cd244 T A 1: 171,577,879 D277E probably benign Het
Cfap157 T C 2: 32,780,678 Y186C probably damaging Het
Ciita C T 16: 10,511,910 A686V probably damaging Het
Clptm1l T C 13: 73,617,765 probably null Het
Col16a1 C T 4: 130,055,994 P50L probably damaging Het
Crisp3 A T 17: 40,235,913 V38D probably damaging Het
Cyfip2 T C 11: 46,221,346 E1010G probably damaging Het
Dvl3 G A 16: 20,527,383 E488K probably damaging Het
Eed C A 7: 89,977,029 E45D probably benign Het
Eln A G 5: 134,725,774 probably benign Het
Fah T A 7: 84,594,835 I239F probably damaging Het
Fbxw5 T A 2: 25,502,436 Y77N possibly damaging Het
Garnl3 T C 2: 33,006,821 E602G possibly damaging Het
Gkn3 A T 6: 87,388,804 M11K probably benign Het
Glt1d1 A G 5: 127,706,981 Y333C probably damaging Het
Gm10762 A T 2: 128,967,170 Y86* probably null Het
Gm14496 A G 2: 182,000,593 M686V probably benign Het
Gse1 T A 8: 120,553,689 probably null Het
Herc4 C A 10: 63,317,418 T1035K probably benign Het
Hmcn2 T A 2: 31,382,478 N1323K probably damaging Het
Hnrnpd T A 5: 99,966,166 E3D probably damaging Het
Htr7 T A 19: 35,969,610 I335F probably damaging Het
Itgae A T 11: 73,145,592 I1119F probably benign Het
Lcn11 T C 2: 25,779,091 F137S probably benign Het
Lrp3 T G 7: 35,203,988 D311A possibly damaging Het
Lrrc1 G T 9: 77,442,191 D364E probably damaging Het
Lrrc37a T A 11: 103,492,179 E2456V unknown Het
Lrriq1 T C 10: 103,227,184 Y87C probably damaging Het
Mcc A T 18: 44,468,390 L449* probably null Het
Mcc A T 18: 44,468,391 L624M probably damaging Het
Mcm9 T C 10: 53,612,839 T496A probably damaging Het
Myef2 T A 2: 125,116,682 D109V probably damaging Het
Myom3 C T 4: 135,762,513 probably benign Het
Nanos1 G T 19: 60,756,539 G92W possibly damaging Het
Ncor1 T A 11: 62,381,414 K84* probably null Het
Neb T A 2: 52,291,082 D1171V probably benign Het
Olfr1167 A T 2: 88,150,016 M1K probably null Het
Olfr26 A C 9: 38,855,637 T192P probably damaging Het
Per2 A G 1: 91,427,763 S758P probably benign Het
Pi4k2a A G 19: 42,090,932 Q144R probably benign Het
Pirb A T 7: 3,717,393 V327E probably benign Het
Pla2g4a C T 1: 149,872,616 W272* probably null Het
Plekha4 T A 7: 45,530,576 M1K probably null Het
Ppt2 A G 17: 34,625,920 C117R probably damaging Het
Prph A T 15: 99,056,386 I222F probably damaging Het
Rbm43 T C 2: 51,925,576 D211G probably damaging Het
Rims2 A G 15: 39,534,855 D1072G probably benign Het
Rnf123 G T 9: 108,068,332 Q380K possibly damaging Het
Rnf145 T C 11: 44,525,105 F49S probably damaging Het
Sall4 A G 2: 168,755,708 I404T probably damaging Het
Slc25a39 G A 11: 102,404,460 P228L probably damaging Het
Tbc1d14 T C 5: 36,520,481 T377A possibly damaging Het
Tbc1d17 A G 7: 44,841,625 I555T probably benign Het
Tmem131l A T 3: 83,922,408 S980T probably damaging Het
Tmem14a G T 1: 21,229,438 L97F possibly damaging Het
Tmem98 T C 11: 80,812,635 V26A probably benign Het
Tmppe G T 9: 114,405,652 G340W probably damaging Het
Tsc1 T C 2: 28,665,601 S237P probably damaging Het
Ttc30b T A 2: 75,937,104 N435I possibly damaging Het
Ubr4 C T 4: 139,444,671 R2992W probably damaging Het
Ugt2a2 A G 5: 87,460,459 V673A possibly damaging Het
Vmn2r19 T C 6: 123,316,108 Y370H possibly damaging Het
Vmn2r20 A G 6: 123,396,383 F500S possibly damaging Het
Zc3h7b A G 15: 81,769,051 Y47C probably benign Het
Zdhhc13 A G 7: 48,815,560 E406G possibly damaging Het
Zfp418 T C 7: 7,182,600 S521P possibly damaging Het
Other mutations in Notch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Notch3 APN 17 32158114 nonsense probably null
IGL01065:Notch3 APN 17 32146416 nonsense probably null
IGL01296:Notch3 APN 17 32166757 missense unknown
IGL01322:Notch3 APN 17 32144471 missense probably damaging 1.00
IGL01343:Notch3 APN 17 32143436 missense probably benign 0.10
IGL01358:Notch3 APN 17 32144747 missense probably damaging 1.00
IGL01600:Notch3 APN 17 32144498 missense probably damaging 1.00
IGL01622:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01623:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01971:Notch3 APN 17 32124347 missense probably damaging 1.00
IGL02000:Notch3 APN 17 32122742 missense probably damaging 0.99
IGL02072:Notch3 APN 17 32147074 nonsense probably null
IGL02145:Notch3 APN 17 32154741 missense probably benign 0.01
IGL02256:Notch3 APN 17 32132324 missense probably damaging 1.00
IGL02366:Notch3 APN 17 32144205 missense probably benign
IGL02476:Notch3 APN 17 32158638 missense possibly damaging 0.67
IGL02502:Notch3 APN 17 32158278 nonsense probably null
IGL02551:Notch3 APN 17 32154731 splice site probably benign
divide UTSW 17 32137813 splice site probably null
Lopressor UTSW 17 32153884 missense probably damaging 1.00
marginal UTSW 17 32164224 missense probably benign
PIT4486001:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R0115:Notch3 UTSW 17 32133462 missense possibly damaging 0.82
R0201:Notch3 UTSW 17 32156148 splice site probably benign
R0630:Notch3 UTSW 17 32147472 splice site probably benign
R1167:Notch3 UTSW 17 32122745 missense possibly damaging 0.95
R1432:Notch3 UTSW 17 32164224 missense probably benign
R1567:Notch3 UTSW 17 32158580 missense possibly damaging 0.77
R1623:Notch3 UTSW 17 32139191 missense probably benign 0.00
R1663:Notch3 UTSW 17 32156119 missense probably damaging 1.00
R1668:Notch3 UTSW 17 32158589 missense probably damaging 0.99
R1789:Notch3 UTSW 17 32158725 missense probably damaging 1.00
R1813:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1837:Notch3 UTSW 17 32124322 missense probably damaging 1.00
R1896:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1937:Notch3 UTSW 17 32153852 missense probably benign 0.03
R1954:Notch3 UTSW 17 32166678 missense probably benign
R2014:Notch3 UTSW 17 32158000 missense probably benign 0.00
R2058:Notch3 UTSW 17 32143644 missense probably benign
R2068:Notch3 UTSW 17 32135508 missense probably benign 0.00
R2097:Notch3 UTSW 17 32122754 missense probably damaging 1.00
R2112:Notch3 UTSW 17 32144610 missense probably benign 0.19
R2156:Notch3 UTSW 17 32147844 missense probably damaging 1.00
R2211:Notch3 UTSW 17 32147978 missense probably benign 0.00
R2324:Notch3 UTSW 17 32150134 splice site probably benign
R2432:Notch3 UTSW 17 32153804 missense probably damaging 1.00
R3117:Notch3 UTSW 17 32158115 missense probably damaging 1.00
R3236:Notch3 UTSW 17 32158461 missense probably damaging 0.96
R3409:Notch3 UTSW 17 32150702 missense possibly damaging 0.67
R3434:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3435:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3438:Notch3 UTSW 17 32153590 missense probably damaging 1.00
R3926:Notch3 UTSW 17 32153557 missense possibly damaging 0.92
R4087:Notch3 UTSW 17 32158113 missense possibly damaging 0.60
R4115:Notch3 UTSW 17 32158433 missense probably damaging 1.00
R4214:Notch3 UTSW 17 32132207 missense possibly damaging 0.96
R4234:Notch3 UTSW 17 32141341 missense probably damaging 0.97
R4242:Notch3 UTSW 17 32143745 missense possibly damaging 0.74
R4658:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R4878:Notch3 UTSW 17 32147085 missense probably damaging 1.00
R4879:Notch3 UTSW 17 32147963 missense probably benign 0.00
R4885:Notch3 UTSW 17 32141377 missense probably damaging 0.98
R4924:Notch3 UTSW 17 32144731 missense probably damaging 1.00
R5084:Notch3 UTSW 17 32157890 critical splice donor site probably null
R5086:Notch3 UTSW 17 32143334 missense probably benign 0.13
R5343:Notch3 UTSW 17 32143283 missense probably benign 0.03
R5389:Notch3 UTSW 17 32139189 missense probably benign
R5503:Notch3 UTSW 17 32147055 missense probably benign 0.00
R5698:Notch3 UTSW 17 32157987 missense probably damaging 1.00
R5824:Notch3 UTSW 17 32153861 missense possibly damaging 0.92
R5969:Notch3 UTSW 17 32153884 missense probably damaging 1.00
R6050:Notch3 UTSW 17 32143527 missense probably benign
R6274:Notch3 UTSW 17 32147290 missense probably benign
R6276:Notch3 UTSW 17 32154749 missense probably benign 0.10
R6313:Notch3 UTSW 17 32151154 splice site probably null
R6316:Notch3 UTSW 17 32137813 splice site probably null
R6380:Notch3 UTSW 17 32144559 missense probably damaging 1.00
R6401:Notch3 UTSW 17 32158623 missense probably benign 0.01
R6741:Notch3 UTSW 17 32143484 missense probably benign 0.16
R7131:Notch3 UTSW 17 32144217 missense probably benign
R7140:Notch3 UTSW 17 32156377 missense possibly damaging 0.84
R7162:Notch3 UTSW 17 32146449 missense probably damaging 0.98
R7171:Notch3 UTSW 17 32158962 missense probably damaging 1.00
R7449:Notch3 UTSW 17 32157966 missense probably damaging 1.00
R7450:Notch3 UTSW 17 32141391 missense possibly damaging 0.69
R7554:Notch3 UTSW 17 32122371 missense probably benign 0.03
R7575:Notch3 UTSW 17 32154819 missense possibly damaging 0.81
R7632:Notch3 UTSW 17 32158506 missense probably benign
R7633:Notch3 UTSW 17 32158622 missense probably benign 0.17
R7860:Notch3 UTSW 17 32122773 missense possibly damaging 0.67
R8052:Notch3 UTSW 17 32146571 missense probably damaging 1.00
R8250:Notch3 UTSW 17 32132336 missense probably damaging 1.00
R8296:Notch3 UTSW 17 32122739 missense probably damaging 1.00
R8306:Notch3 UTSW 17 32158112 missense probably damaging 0.99
R8458:Notch3 UTSW 17 32156050 missense probably damaging 1.00
R8539:Notch3 UTSW 17 32156355 missense possibly damaging 0.92
T0975:Notch3 UTSW 17 32146417 missense probably damaging 0.99
Z1088:Notch3 UTSW 17 32158652 missense possibly damaging 0.94
Z1176:Notch3 UTSW 17 32141516 missense probably benign 0.12
Z1176:Notch3 UTSW 17 32151370 missense probably damaging 1.00
Z1177:Notch3 UTSW 17 32166694 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGTAGGTTGAAGCAGGTACC -3'
(R):5'- TCACATATGACTGTGCTTGCC -3'

Sequencing Primer
(F):5'- TTGAAGCAGGTACCCCCATTGTG -3'
(R):5'- CCTGGTAAGTAAGTTGTGCCCAG -3'
Posted On2018-06-06