Incidental Mutation 'R6502:Pi4k2a'
ID519832
Institutional Source Beutler Lab
Gene Symbol Pi4k2a
Ensembl Gene ENSMUSG00000025178
Gene Namephosphatidylinositol 4-kinase type 2 alpha
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #R6502 (G1)
Quality Score88.0076
Status Not validated
Chromosome19
Chromosomal Location42090435-42122218 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42090932 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 144 (Q144R)
Ref Sequence ENSEMBL: ENSMUSP00000069284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051772] [ENSMUST00000066778]
Predicted Effect probably benign
Transcript: ENSMUST00000051772
SMART Domains Protein: ENSMUSP00000062887
Gene: ENSMUSG00000049670

DomainStartEndE-ValueType
MORN 14 35 1.64e-5 SMART
MORN 37 58 4.15e-2 SMART
MORN 60 81 1.86e-4 SMART
MORN 83 104 1.84e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000066778
AA Change: Q144R

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000069284
Gene: ENSMUSG00000025178
AA Change: Q144R

DomainStartEndE-ValueType
low complexity region 31 53 N/A INTRINSIC
low complexity region 68 98 N/A INTRINSIC
Pfam:PI3_PI4_kinase 133 431 1.7e-67 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositolpolyphosphates (PtdInsPs) are centrally involved in many biologic processes, ranging from cell growth and organization of the actin cytoskeleton to endo- and exocytosis. PI4KII phosphorylates PtdIns at the D-4 position, an essential step in the biosynthesis of PtdInsPs (Barylko et al., 2001 [PubMed 11244087]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele develop a progressive neurologic disease typified by urinary incontinence, tremor, limb weakness, weight loss, cerebellar gliosis, Purkinje cell loss, degeneration of spinal cord axons and premature death. Mutant males are sterile while females are subfertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,356,949 I24K probably benign Het
Adamts9 A T 6: 92,872,335 C467S probably damaging Het
Adcy7 G A 8: 88,325,479 R925Q probably damaging Het
Akap6 G A 12: 53,140,215 G1471S probably damaging Het
Ap2b1 T C 11: 83,342,679 V506A probably damaging Het
Apob A G 12: 8,001,814 I1113M probably damaging Het
Arsg A T 11: 109,517,336 N105Y probably damaging Het
Blm T A 7: 80,481,475 Y872F probably damaging Het
Btaf1 A T 19: 36,983,617 N797Y probably benign Het
Camsap1 T C 2: 25,956,308 E201G probably damaging Het
Ccdc122 T A 14: 77,042,069 probably null Homo
Ccdc141 A G 2: 77,170,401 V29A probably damaging Het
Cd244 T A 1: 171,577,879 D277E probably benign Het
Cfap157 T C 2: 32,780,678 Y186C probably damaging Het
Ciita C T 16: 10,511,910 A686V probably damaging Het
Clptm1l T C 13: 73,617,765 probably null Het
Col16a1 C T 4: 130,055,994 P50L probably damaging Het
Crisp3 A T 17: 40,235,913 V38D probably damaging Het
Cyfip2 T C 11: 46,221,346 E1010G probably damaging Het
Dvl3 G A 16: 20,527,383 E488K probably damaging Het
Eed C A 7: 89,977,029 E45D probably benign Het
Eln A G 5: 134,725,774 probably benign Het
Fah T A 7: 84,594,835 I239F probably damaging Het
Fbxw5 T A 2: 25,502,436 Y77N possibly damaging Het
Garnl3 T C 2: 33,006,821 E602G possibly damaging Het
Gkn3 A T 6: 87,388,804 M11K probably benign Het
Glt1d1 A G 5: 127,706,981 Y333C probably damaging Het
Gm10762 A T 2: 128,967,170 Y86* probably null Het
Gm14496 A G 2: 182,000,593 M686V probably benign Het
Gse1 T A 8: 120,553,689 probably null Het
Herc4 C A 10: 63,317,418 T1035K probably benign Het
Hmcn2 T A 2: 31,382,478 N1323K probably damaging Het
Hnrnpd T A 5: 99,966,166 E3D probably damaging Het
Htr7 T A 19: 35,969,610 I335F probably damaging Het
Itgae A T 11: 73,145,592 I1119F probably benign Het
Lcn11 T C 2: 25,779,091 F137S probably benign Het
Lrp3 T G 7: 35,203,988 D311A possibly damaging Het
Lrrc1 G T 9: 77,442,191 D364E probably damaging Het
Lrrc37a T A 11: 103,492,179 E2456V unknown Het
Lrriq1 T C 10: 103,227,184 Y87C probably damaging Het
Mcc A T 18: 44,468,390 L449* probably null Het
Mcc A T 18: 44,468,391 L624M probably damaging Het
Mcm9 T C 10: 53,612,839 T496A probably damaging Het
Myef2 T A 2: 125,116,682 D109V probably damaging Het
Myom3 C T 4: 135,762,513 probably benign Het
Nanos1 G T 19: 60,756,539 G92W possibly damaging Het
Ncor1 T A 11: 62,381,414 K84* probably null Het
Neb T A 2: 52,291,082 D1171V probably benign Het
Notch3 A G 17: 32,158,217 W267R probably damaging Het
Olfr1167 A T 2: 88,150,016 M1K probably null Het
Olfr26 A C 9: 38,855,637 T192P probably damaging Het
Per2 A G 1: 91,427,763 S758P probably benign Het
Pirb A T 7: 3,717,393 V327E probably benign Het
Pla2g4a C T 1: 149,872,616 W272* probably null Het
Plekha4 T A 7: 45,530,576 M1K probably null Het
Ppt2 A G 17: 34,625,920 C117R probably damaging Het
Prph A T 15: 99,056,386 I222F probably damaging Het
Rbm43 T C 2: 51,925,576 D211G probably damaging Het
Rims2 A G 15: 39,534,855 D1072G probably benign Het
Rnf123 G T 9: 108,068,332 Q380K possibly damaging Het
Rnf145 T C 11: 44,525,105 F49S probably damaging Het
Sall4 A G 2: 168,755,708 I404T probably damaging Het
Slc25a39 G A 11: 102,404,460 P228L probably damaging Het
Tbc1d14 T C 5: 36,520,481 T377A possibly damaging Het
Tbc1d17 A G 7: 44,841,625 I555T probably benign Het
Tmem131l A T 3: 83,922,408 S980T probably damaging Het
Tmem14a G T 1: 21,229,438 L97F possibly damaging Het
Tmem98 T C 11: 80,812,635 V26A probably benign Het
Tmppe G T 9: 114,405,652 G340W probably damaging Het
Tsc1 T C 2: 28,665,601 S237P probably damaging Het
Ttc30b T A 2: 75,937,104 N435I possibly damaging Het
Ubr4 C T 4: 139,444,671 R2992W probably damaging Het
Ugt2a2 A G 5: 87,460,459 V673A possibly damaging Het
Vmn2r19 T C 6: 123,316,108 Y370H possibly damaging Het
Vmn2r20 A G 6: 123,396,383 F500S possibly damaging Het
Zc3h7b A G 15: 81,769,051 Y47C probably benign Het
Zdhhc13 A G 7: 48,815,560 E406G possibly damaging Het
Zfp418 T C 7: 7,182,600 S521P possibly damaging Het
Other mutations in Pi4k2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01710:Pi4k2a APN 19 42104979 missense probably damaging 1.00
IGL02959:Pi4k2a APN 19 42113071 missense probably benign 0.42
R1570:Pi4k2a UTSW 19 42100644 missense probably benign 0.33
R1992:Pi4k2a UTSW 19 42115938 missense probably damaging 1.00
R2113:Pi4k2a UTSW 19 42115071 missense possibly damaging 0.78
R2358:Pi4k2a UTSW 19 42090692 missense probably damaging 0.99
R2410:Pi4k2a UTSW 19 42104877 missense possibly damaging 0.55
R3547:Pi4k2a UTSW 19 42090548 missense probably benign 0.10
R3708:Pi4k2a UTSW 19 42090931 nonsense probably null
R3712:Pi4k2a UTSW 19 42090692 missense probably damaging 0.99
R3954:Pi4k2a UTSW 19 42115899 missense probably damaging 0.98
R4654:Pi4k2a UTSW 19 42113105 critical splice donor site probably null
R5077:Pi4k2a UTSW 19 42119836 unclassified probably null
R5386:Pi4k2a UTSW 19 42090515 missense probably damaging 0.99
R5846:Pi4k2a UTSW 19 42115038 missense probably benign 0.01
R5867:Pi4k2a UTSW 19 42105485 critical splice donor site probably null
R5878:Pi4k2a UTSW 19 42100641 missense probably benign 0.02
R7042:Pi4k2a UTSW 19 42104898 missense probably benign 0.18
R7269:Pi4k2a UTSW 19 42090686 missense probably damaging 1.00
R7819:Pi4k2a UTSW 19 42090574 missense probably benign
Z1177:Pi4k2a UTSW 19 42104925 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCACTTTCCGCAAGTACCGG -3'
(R):5'- AGCTTGGGTCAGGACTTTTC -3'

Sequencing Primer
(F):5'- AGACCCACACGGTGGCGGTGCA -3'
(R):5'- CCCCTGCAAAAAGGTTCTGATTG -3'
Posted On2018-06-06