Incidental Mutation 'R6509:Vmn2r66'
ID 519865
Institutional Source Beutler Lab
Gene Symbol Vmn2r66
Ensembl Gene ENSMUSG00000094950
Gene Name vomeronasal 2, receptor 66
Synonyms F830104D24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R6509 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 84994645-85012020 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 85006846 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 321 (P321T)
Ref Sequence ENSEMBL: ENSMUSP00000122645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124773]
AlphaFold A0A3B2W842
Predicted Effect probably benign
Transcript: ENSMUST00000124773
AA Change: P321T

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122645
Gene: ENSMUSG00000094950
AA Change: P321T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 5e-31 PFAM
Pfam:NCD3G 507 559 6e-21 PFAM
Pfam:7tm_3 589 827 3.8e-52 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik C T 5: 98,329,397 T15I probably benign Het
4930522L14Rik G A 5: 109,737,384 R203* probably null Het
Ccnc A G 4: 21,740,642 N133D probably benign Het
Lbhd2 A G 12: 111,410,313 R65G possibly damaging Het
Lrrc37a A G 11: 103,504,414 S62P probably benign Het
Map3k1 T A 13: 111,753,829 M1279L possibly damaging Het
Ncapg2 G A 12: 116,427,756 R475Q probably damaging Het
Nlrp5 A T 7: 23,417,916 N355I probably damaging Het
Olfr847 A G 9: 19,375,143 V246A probably benign Het
Pdzd8 A G 19: 59,344,866 F241S probably benign Het
Rgl3 A G 9: 21,971,908 S705P probably benign Het
Rsbn1 A G 3: 103,960,032 Y563C probably damaging Het
Sept9 A G 11: 117,290,427 I18V probably benign Het
Sycp2 G A 2: 178,395,894 P153S probably damaging Het
Tbc1d4 C A 14: 101,608,318 R48L possibly damaging Het
Vmn1r195 G A 13: 22,279,109 G250R probably benign Het
Other mutations in Vmn2r66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Vmn2r66 APN 7 85007091 missense probably benign
IGL01562:Vmn2r66 APN 7 85007287 missense probably benign 0.03
IGL01689:Vmn2r66 APN 7 85007825 missense probably damaging 1.00
IGL02237:Vmn2r66 APN 7 84994700 missense probably benign
IGL02415:Vmn2r66 APN 7 85006812 missense probably damaging 0.97
IGL02439:Vmn2r66 APN 7 85005247 splice site probably benign
IGL02545:Vmn2r66 APN 7 85006590 missense possibly damaging 0.50
IGL02708:Vmn2r66 APN 7 85006588 missense probably benign 0.00
IGL02794:Vmn2r66 APN 7 84995415 missense probably benign 0.00
IGL02885:Vmn2r66 APN 7 84995515 missense probably benign 0.00
IGL02975:Vmn2r66 APN 7 85006974 missense probably damaging 0.98
IGL03027:Vmn2r66 APN 7 84995569 splice site probably benign
IGL03081:Vmn2r66 APN 7 85007930 missense probably benign
PIT4131001:Vmn2r66 UTSW 7 84995093 missense probably damaging 1.00
R0098:Vmn2r66 UTSW 7 85005757 missense probably damaging 1.00
R0504:Vmn2r66 UTSW 7 85006815 missense probably damaging 0.99
R0557:Vmn2r66 UTSW 7 84994764 missense probably damaging 1.00
R0617:Vmn2r66 UTSW 7 84995276 missense probably benign 0.02
R0883:Vmn2r66 UTSW 7 85007862 missense probably benign
R1159:Vmn2r66 UTSW 7 84995405 missense probably benign 0.44
R1168:Vmn2r66 UTSW 7 85006854 missense possibly damaging 0.46
R1172:Vmn2r66 UTSW 7 85005591 missense probably benign 0.04
R1175:Vmn2r66 UTSW 7 85005591 missense probably benign 0.04
R1538:Vmn2r66 UTSW 7 84994958 missense possibly damaging 0.84
R1658:Vmn2r66 UTSW 7 85007747 missense probably benign 0.07
R1937:Vmn2r66 UTSW 7 84995136 missense probably damaging 0.99
R1989:Vmn2r66 UTSW 7 85011993 missense probably benign 0.01
R2698:Vmn2r66 UTSW 7 84995399 missense probably damaging 1.00
R2890:Vmn2r66 UTSW 7 85011819 splice site probably null
R3686:Vmn2r66 UTSW 7 84995189 missense probably damaging 0.96
R4152:Vmn2r66 UTSW 7 85005592 missense probably benign 0.08
R4500:Vmn2r66 UTSW 7 85007954 missense probably damaging 1.00
R4618:Vmn2r66 UTSW 7 84995088 missense possibly damaging 0.62
R4656:Vmn2r66 UTSW 7 85011996 missense possibly damaging 0.87
R4668:Vmn2r66 UTSW 7 84994697 missense probably damaging 1.00
R4942:Vmn2r66 UTSW 7 85007772 missense probably damaging 1.00
R5163:Vmn2r66 UTSW 7 85006809 missense probably benign 0.01
R5223:Vmn2r66 UTSW 7 85007885 missense probably benign
R5377:Vmn2r66 UTSW 7 85006818 missense probably damaging 0.99
R5512:Vmn2r66 UTSW 7 85007941 missense probably damaging 1.00
R5611:Vmn2r66 UTSW 7 85005743 nonsense probably null
R5749:Vmn2r66 UTSW 7 85006771 nonsense probably null
R6131:Vmn2r66 UTSW 7 84995016 missense probably damaging 1.00
R6183:Vmn2r66 UTSW 7 84995558 missense possibly damaging 0.81
R6930:Vmn2r66 UTSW 7 85012008 missense possibly damaging 0.80
R6992:Vmn2r66 UTSW 7 85005228 missense possibly damaging 0.90
R7015:Vmn2r66 UTSW 7 84995558 missense possibly damaging 0.81
R7302:Vmn2r66 UTSW 7 85005215 missense probably benign 0.00
R7516:Vmn2r66 UTSW 7 85011968 missense possibly damaging 0.51
R7763:Vmn2r66 UTSW 7 85005701 missense probably benign 0.01
R7814:Vmn2r66 UTSW 7 85007264 missense probably benign 0.02
R8077:Vmn2r66 UTSW 7 85006885 missense probably benign
R8307:Vmn2r66 UTSW 7 85007062 missense probably benign
R8315:Vmn2r66 UTSW 7 84994724 missense possibly damaging 0.90
R8490:Vmn2r66 UTSW 7 85005586 critical splice donor site probably null
R8511:Vmn2r66 UTSW 7 85006818 missense probably damaging 0.99
R8781:Vmn2r66 UTSW 7 84995147 nonsense probably null
R8812:Vmn2r66 UTSW 7 85005685 missense probably damaging 0.99
R9203:Vmn2r66 UTSW 7 85005742 missense probably benign 0.01
R9277:Vmn2r66 UTSW 7 85011956 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAAGTGGTGTCATGAATAACC -3'
(R):5'- GGCCCTTAAAGAGTTTCATACGC -3'

Sequencing Primer
(F):5'- CCATTTAAATACAGTTGTGGTTGGAC -3'
(R):5'- AGAGTTTCATACGCATTACAACC -3'
Posted On 2018-06-06