Mutagenetix > Incidental Mutations

Incidental Mutation 'R6509:Vmn2r66'

519865

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r66

Ensembl Gene

ENSMUSG00000094950

Gene Name

vomeronasal 2, receptor 66

Synonyms

F830104D24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.070) question?

Stock #

R6509 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84994645-85012020 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 85006846 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 321 (P321T)

Ref Sequence

ENSEMBL: ENSMUSP00000122645 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124773]

AlphaFold

A0A3B2W842

Predicted Effect

probably benign
Transcript: ENSMUST00000124773
AA Change: P321T

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000122645
Gene: ENSMUSG00000094950
AA Change: P321T

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	463	5e-31	PFAM
Pfam:NCD3G	507	559	6e-21	PFAM
Pfam:7tm_3	589	827	3.8e-52	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.7%
20x: 92.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 16 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	C	T	5: 98,329,397	T15I	probably benign	Het
4930522L14Rik	G	A	5: 109,737,384	R203*	probably null	Het
Ccnc	A	G	4: 21,740,642	N133D	probably benign	Het
Lbhd2	A	G	12: 111,410,313	R65G	possibly damaging	Het
Lrrc37a	A	G	11: 103,504,414	S62P	probably benign	Het
Map3k1	T	A	13: 111,753,829	M1279L	possibly damaging	Het
Ncapg2	G	A	12: 116,427,756	R475Q	probably damaging	Het
Nlrp5	A	T	7: 23,417,916	N355I	probably damaging	Het
Olfr847	A	G	9: 19,375,143	V246A	probably benign	Het
Pdzd8	A	G	19: 59,344,866	F241S	probably benign	Het
Rgl3	A	G	9: 21,971,908	S705P	probably benign	Het
Rsbn1	A	G	3: 103,960,032	Y563C	probably damaging	Het
Sept9	A	G	11: 117,290,427	I18V	probably benign	Het
Sycp2	G	A	2: 178,395,894	P153S	probably damaging	Het
Tbc1d4	C	A	14: 101,608,318	R48L	possibly damaging	Het
Vmn1r195	G	A	13: 22,279,109	G250R	probably benign	Het

Other mutations in Vmn2r66

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Vmn2r66	APN	7	85007091	missense	probably benign
IGL01562:Vmn2r66	APN	7	85007287	missense	probably benign	0.03
IGL01689:Vmn2r66	APN	7	85007825	missense	probably damaging	1.00
IGL02237:Vmn2r66	APN	7	84994700	missense	probably benign
IGL02415:Vmn2r66	APN	7	85006812	missense	probably damaging	0.97
IGL02439:Vmn2r66	APN	7	85005247	splice site	probably benign
IGL02545:Vmn2r66	APN	7	85006590	missense	possibly damaging	0.50
IGL02708:Vmn2r66	APN	7	85006588	missense	probably benign	0.00
IGL02794:Vmn2r66	APN	7	84995415	missense	probably benign	0.00
IGL02885:Vmn2r66	APN	7	84995515	missense	probably benign	0.00
IGL02975:Vmn2r66	APN	7	85006974	missense	probably damaging	0.98
IGL03027:Vmn2r66	APN	7	84995569	splice site	probably benign
IGL03081:Vmn2r66	APN	7	85007930	missense	probably benign
PIT4131001:Vmn2r66	UTSW	7	84995093	missense	probably damaging	1.00
R0098:Vmn2r66	UTSW	7	85005757	missense	probably damaging	1.00
R0504:Vmn2r66	UTSW	7	85006815	missense	probably damaging	0.99
R0557:Vmn2r66	UTSW	7	84994764	missense	probably damaging	1.00
R0617:Vmn2r66	UTSW	7	84995276	missense	probably benign	0.02
R0883:Vmn2r66	UTSW	7	85007862	missense	probably benign
R1159:Vmn2r66	UTSW	7	84995405	missense	probably benign	0.44
R1168:Vmn2r66	UTSW	7	85006854	missense	possibly damaging	0.46
R1172:Vmn2r66	UTSW	7	85005591	missense	probably benign	0.04
R1175:Vmn2r66	UTSW	7	85005591	missense	probably benign	0.04
R1538:Vmn2r66	UTSW	7	84994958	missense	possibly damaging	0.84
R1658:Vmn2r66	UTSW	7	85007747	missense	probably benign	0.07
R1937:Vmn2r66	UTSW	7	84995136	missense	probably damaging	0.99
R1989:Vmn2r66	UTSW	7	85011993	missense	probably benign	0.01
R2698:Vmn2r66	UTSW	7	84995399	missense	probably damaging	1.00
R2890:Vmn2r66	UTSW	7	85011819	splice site	probably null
R3686:Vmn2r66	UTSW	7	84995189	missense	probably damaging	0.96
R4152:Vmn2r66	UTSW	7	85005592	missense	probably benign	0.08
R4500:Vmn2r66	UTSW	7	85007954	missense	probably damaging	1.00
R4618:Vmn2r66	UTSW	7	84995088	missense	possibly damaging	0.62
R4656:Vmn2r66	UTSW	7	85011996	missense	possibly damaging	0.87
R4668:Vmn2r66	UTSW	7	84994697	missense	probably damaging	1.00
R4942:Vmn2r66	UTSW	7	85007772	missense	probably damaging	1.00
R5163:Vmn2r66	UTSW	7	85006809	missense	probably benign	0.01
R5223:Vmn2r66	UTSW	7	85007885	missense	probably benign
R5377:Vmn2r66	UTSW	7	85006818	missense	probably damaging	0.99
R5512:Vmn2r66	UTSW	7	85007941	missense	probably damaging	1.00
R5611:Vmn2r66	UTSW	7	85005743	nonsense	probably null
R5749:Vmn2r66	UTSW	7	85006771	nonsense	probably null
R6131:Vmn2r66	UTSW	7	84995016	missense	probably damaging	1.00
R6183:Vmn2r66	UTSW	7	84995558	missense	possibly damaging	0.81
R6930:Vmn2r66	UTSW	7	85012008	missense	possibly damaging	0.80
R6992:Vmn2r66	UTSW	7	85005228	missense	possibly damaging	0.90
R7015:Vmn2r66	UTSW	7	84995558	missense	possibly damaging	0.81
R7302:Vmn2r66	UTSW	7	85005215	missense	probably benign	0.00
R7516:Vmn2r66	UTSW	7	85011968	missense	possibly damaging	0.51
R7763:Vmn2r66	UTSW	7	85005701	missense	probably benign	0.01
R7814:Vmn2r66	UTSW	7	85007264	missense	probably benign	0.02
R8077:Vmn2r66	UTSW	7	85006885	missense	probably benign
R8307:Vmn2r66	UTSW	7	85007062	missense	probably benign
R8315:Vmn2r66	UTSW	7	84994724	missense	possibly damaging	0.90
R8490:Vmn2r66	UTSW	7	85005586	critical splice donor site	probably null
R8511:Vmn2r66	UTSW	7	85006818	missense	probably damaging	0.99
R8781:Vmn2r66	UTSW	7	84995147	nonsense	probably null
R8812:Vmn2r66	UTSW	7	85005685	missense	probably damaging	0.99
R9203:Vmn2r66	UTSW	7	85005742	missense	probably benign	0.01
R9277:Vmn2r66	UTSW	7	85011956	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCAAGTGGTGTCATGAATAACC -3'
(R):5'- GGCCCTTAAAGAGTTTCATACGC -3'

Sequencing Primer
(F):5'- CCATTTAAATACAGTTGTGGTTGGAC -3'
(R):5'- AGAGTTTCATACGCATTACAACC -3'

Posted On

2018-06-06